ID: 1036022987 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:4869317-4869339 |
| Sequence | AGTTGTGTCTGTAGGGAAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036022980_1036022987 | 13 | Left | 1036022980 | 8:4869281-4869303 | CCATCCTGTTTTATCATTTGATG | 0: 1 1: 0 2: 0 3: 26 4: 333 |
||
| Right | 1036022987 | 8:4869317-4869339 | AGTTGTGTCTGTAGGGAAACTGG | No data | ||||
| 1036022982_1036022987 | 9 | Left | 1036022982 | 8:4869285-4869307 | CCTGTTTTATCATTTGATGGAAA | 0: 1 1: 0 2: 2 3: 26 4: 262 |
||
| Right | 1036022987 | 8:4869317-4869339 | AGTTGTGTCTGTAGGGAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036022987 | Original CRISPR | AGTTGTGTCTGTAGGGAAAC TGG | Intronic | ||
| No off target data available for this crispr | |||||