ID: 1036022987

View in Genome Browser
Species Human (GRCh38)
Location 8:4869317-4869339
Sequence AGTTGTGTCTGTAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036022980_1036022987 13 Left 1036022980 8:4869281-4869303 CCATCCTGTTTTATCATTTGATG 0: 1
1: 0
2: 0
3: 26
4: 333
Right 1036022987 8:4869317-4869339 AGTTGTGTCTGTAGGGAAACTGG No data
1036022982_1036022987 9 Left 1036022982 8:4869285-4869307 CCTGTTTTATCATTTGATGGAAA 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1036022987 8:4869317-4869339 AGTTGTGTCTGTAGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036022987 Original CRISPR AGTTGTGTCTGTAGGGAAAC TGG Intronic
No off target data available for this crispr