ID: 1036024769

View in Genome Browser
Species Human (GRCh38)
Location 8:4893858-4893880
Sequence TTTCTGTTTTTGGGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 1, 1: 0, 2: 5, 3: 92, 4: 883}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036024769_1036024773 -4 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024773 8:4893877-4893899 GAAAAAAATCTATTTAACCAAGG No data
1036024769_1036024778 3 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024778 8:4893884-4893906 ATCTATTTAACCAAGGGGGCGGG No data
1036024769_1036024781 29 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024781 8:4893910-4893932 ATGTCTTTTTCGCAAAATGTTGG No data
1036024769_1036024776 -1 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024776 8:4893880-4893902 AAAAATCTATTTAACCAAGGGGG No data
1036024769_1036024774 -3 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024774 8:4893878-4893900 AAAAAAATCTATTTAACCAAGGG No data
1036024769_1036024775 -2 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024775 8:4893879-4893901 AAAAAATCTATTTAACCAAGGGG No data
1036024769_1036024779 4 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024779 8:4893885-4893907 TCTATTTAACCAAGGGGGCGGGG No data
1036024769_1036024777 2 Left 1036024769 8:4893858-4893880 CCTTTTTTCCCCAAAAACAGAAA 0: 1
1: 0
2: 5
3: 92
4: 883
Right 1036024777 8:4893883-4893905 AATCTATTTAACCAAGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036024769 Original CRISPR TTTCTGTTTTTGGGGAAAAA AGG (reversed) Intronic
900134510 1:1109637-1109659 TTTTTATTTTTTGGTAAAAAGGG + Intronic
900704260 1:4069287-4069309 TTGCTTTTTCTGGGGAATAAAGG - Intergenic
901841276 1:11955467-11955489 TTGCTGATTTTGTGGATAAATGG + Intronic
902259056 1:15210381-15210403 TTTGTTTTTTAGGGGGAAAAGGG - Intronic
902418784 1:16260871-16260893 TTTCTTTTTTTGGGTAGAGATGG + Intronic
902425649 1:16319559-16319581 TCTCTGCTTTTGGGGAATGAAGG - Intronic
902751176 1:18512181-18512203 TTTTTTTTTTTTTGGAAAAACGG - Intergenic
903318681 1:22528535-22528557 TTTCTTTTTTTGGGGGAGACAGG + Exonic
903410853 1:23141686-23141708 TTTGTGTTTTTTTGGAAACAGGG + Intronic
903634888 1:24805586-24805608 GTTCTCTTTCTGGAGAAAAAAGG + Intronic
903788705 1:25878043-25878065 TGCCTGGTTTTGGGGGAAAAGGG - Intergenic
903820265 1:26096598-26096620 GTTCTGTTCCTGGAGAAAAAGGG - Intergenic
903990963 1:27269153-27269175 TTTTTTTTTTTGGAGAAACAGGG - Intronic
904778743 1:32928791-32928813 TTTATGTTTTTGGTGGGAAAGGG + Intergenic
905734104 1:40314540-40314562 TTTTTATTTTTGAGGAAAAGGGG - Intronic
906010248 1:42516665-42516687 TTTCAGCTTATGGTGAAAAATGG - Intronic
906047258 1:42841290-42841312 TTCCTGTATTTGGGGAAGGAAGG + Intronic
907002421 1:50874951-50874973 TTTCTGTTTTTGTAGAGACAGGG + Intronic
907083786 1:51649878-51649900 TTTTTGTTGTTGTTGAAAAAAGG + Intronic
907287522 1:53391304-53391326 TTTCATTTTTTGTGGAAACAGGG + Intergenic
908212899 1:61919654-61919676 TTTCTGTTTTTTGGTACTAAGGG + Intronic
908396763 1:63732296-63732318 TTTCTTTTTTTGGGGGGTAAGGG - Intergenic
908613418 1:65888467-65888489 TTTCTATTTATGTGAAAAAATGG + Intronic
908912053 1:69083263-69083285 TTTCTATTTCTGTAGAAAAATGG - Intergenic
909096398 1:71293414-71293436 TTTGTGTTTTTGGAGAGACAGGG - Intergenic
909276992 1:73699465-73699487 TTTCTGTGTTTTGGGGAAGATGG + Intergenic
909599494 1:77447089-77447111 TTTCAGTCTTTGGGGAAAGCTGG - Intronic
909756436 1:79231486-79231508 TTTGTGTCTTTGGAGAACAAAGG - Intergenic
910026234 1:82657733-82657755 TTTTAGTTCTTGGGGATAAAAGG + Intergenic
910187583 1:84560197-84560219 TGGCTGGTTTTGGGGAAAAGAGG - Intronic
910424548 1:87107003-87107025 TTGCTGCTTTTGTGGTAAAATGG - Exonic
910535007 1:88287736-88287758 ATTCTGTTTTTCTAGAAAAAAGG + Intergenic
910567315 1:88658855-88658877 TTTCTGTTTTAGGAGAAAGGGGG - Intergenic
910653253 1:89592684-89592706 TTTTTTTTTTTTTGGAAAAAAGG + Intronic
910879175 1:91906848-91906870 TTTTTTTTTTTGGCGTAAAATGG + Intergenic
911244632 1:95503428-95503450 CTGCTGTATTTGGGGAATAAAGG + Intergenic
911312470 1:96310962-96310984 TTTTTAATTTTGAGGAAAAAAGG + Intergenic
911611996 1:99968204-99968226 TTGCTGTTTATTGGGAAATAGGG + Intergenic
911845959 1:102750009-102750031 TTTCTGTGTGTGTGGGAAAATGG + Intergenic
912281346 1:108317769-108317791 TTTTTGTTTCTTAGGAAAAAAGG + Intergenic
912444241 1:109722594-109722616 TTTCTGTTTTAGGAGAAAGAGGG - Intronic
912531475 1:110326909-110326931 TTTCTTTTTCTGAAGAAAAAGGG + Intergenic
912686898 1:111775022-111775044 TTTCAGTTTCTGGGAAAGAAAGG - Intronic
912754567 1:112313680-112313702 TTTCTACCTCTGGGGAAAAAGGG + Intergenic
912825834 1:112902342-112902364 CTTCTGTTTTTAGGAAAAATTGG + Intergenic
913413962 1:118584231-118584253 TTCCTGTTTTTGAGAAAATAAGG + Intergenic
913527691 1:119709692-119709714 TTTTTCTTTTTGAGGAAAGAAGG + Intronic
914170810 1:145221807-145221829 ATTGTGTTTCTGGTGAAAAAGGG + Intergenic
914525925 1:148465766-148465788 ATTGTGTTTCTGGTGAAAAAGGG + Intergenic
914640477 1:149601350-149601372 ATTGTGTTTCTGGTGAAAAAGGG - Intergenic
915671081 1:157489593-157489615 TTTCTGGATTTGAGGAAAAAAGG + Intergenic
916062973 1:161114301-161114323 TTTCTGTCTTTGGTGGATAATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917761499 1:178164008-178164030 TTCCTGTTTTTGTTTAAAAAAGG + Intronic
917852762 1:179079521-179079543 TTTTTTTTTTTGGAAAAAAACGG + Intergenic
918015143 1:180625891-180625913 TTTATCTTTTTGGGGAAACACGG - Intergenic
918144099 1:181740767-181740789 TTTCTTTTTGTGGGGGACAAAGG - Intronic
918530093 1:185509672-185509694 TGTCTGTTACTGGGGAGAAAAGG + Intergenic
918875400 1:190034914-190034936 TTTTTCTTTTTGTGGAAAACAGG - Intergenic
919100162 1:193086178-193086200 TTTATGTTTTTTGGGAAAGGGGG + Intronic
919522441 1:198605425-198605447 TTTTCCTTATTGGGGAAAAAAGG + Intergenic
920699923 1:208210157-208210179 TTTATTTTCTTGGGGAACAAAGG - Intronic
921358057 1:214305173-214305195 TTTCTGTTTTTAAGGAAAGAAGG + Exonic
921359200 1:214314802-214314824 TGGTTGTTTTTGGGGAAAACTGG + Exonic
921583823 1:216925572-216925594 TTTCTGTTTTTGGGGGGACAGGG + Intronic
922111755 1:222565687-222565709 TTTGTATTTTTGGAGAAACAGGG - Intronic
922120909 1:222666682-222666704 GTTCTGTTTTAGGGGGAAATGGG + Exonic
922694879 1:227724917-227724939 TTTACCTTCTTGGGGAAAAAAGG - Intergenic
922805978 1:228389718-228389740 TTTTTTTTTTTGGGGATACAGGG - Intergenic
923186556 1:231578959-231578981 TTTTTTTTTTTTGGGAAACAGGG + Intronic
923333783 1:232949849-232949871 CTCCTGTTTTTTGGGAAAACGGG - Intergenic
923761741 1:236852467-236852489 TTGCTGTTTTTGGCAAAAAAGGG + Intronic
924615812 1:245610982-245611004 CTCCTCTTTTTGGGGAGAAAAGG - Intronic
1062865047 10:845233-845255 TTTTTGTTTTGGGGGATAAAGGG - Intronic
1063516777 10:6704376-6704398 TTTTTGTTTTTGGAGAAACAAGG + Intergenic
1063974099 10:11401662-11401684 TCTTTTGTTTTGGGGAAAAATGG + Intergenic
1063979602 10:11443093-11443115 TTTCTGTTTTTGTTGTAAACAGG - Intergenic
1064164857 10:12977101-12977123 TTTCTGTTTTTTGGTAGAGATGG - Intronic
1064214330 10:13386930-13386952 TTTGTATTTTTGGTGAAAATAGG - Intergenic
1064248232 10:13686561-13686583 TTTCTGTTCTGGGAGAAAACAGG - Intronic
1064736237 10:18384551-18384573 TTTCTTTTTTTGGAGAGACAGGG - Intronic
1064839401 10:19573577-19573599 TTTCTTTTTTAGGGGGAAAGGGG - Intronic
1064917883 10:20482054-20482076 TTTCTATTTCTGTGAAAAAATGG + Intergenic
1065106638 10:22394881-22394903 TTTCTTTTTTTGGAGAGACAGGG + Intronic
1065377922 10:25061487-25061509 TTTCTATTTTCAGGAAAAAAAGG + Intronic
1065444065 10:25779623-25779645 TTTCTGTTTTTGAGATAAGACGG + Intergenic
1065642027 10:27793021-27793043 TTTCTTTTTTTGGAGTAATATGG + Intergenic
1065925957 10:30434042-30434064 TTTCTGTTTACGGAGAGAAAGGG + Exonic
1065955523 10:30690477-30690499 TTTCTGTTTTTGGAGAGATGGGG + Intergenic
1066240231 10:33526586-33526608 TTTTTTTTTTTGGAGAAATAAGG - Intergenic
1066406065 10:35119738-35119760 TTTCTTTTTTTTGGTAAAGATGG + Intergenic
1066598014 10:37074107-37074129 TTGCTGTTTTTAGTGATAAATGG - Intergenic
1067257673 10:44660237-44660259 TGTCAGTTATTGGGGACAAAAGG - Intergenic
1067656546 10:48196488-48196510 TGTCTGTTTTTGGTGACAAGTGG + Intronic
1068167870 10:53354769-53354791 TTTCTGTTTTTGGTAGAAACAGG - Intergenic
1068219359 10:54024839-54024861 CCTCTTTTTTTGGTGAAAAAGGG - Intronic
1068430579 10:56926743-56926765 TGTCTCTTGTTGGGTAAAAATGG + Intergenic
1068572605 10:58646931-58646953 TTTCTGTTTTTAAGTAAAAATGG + Intronic
1069024384 10:63523458-63523480 TTTCTTTTTTTGTGGAGACAAGG - Intronic
1069132675 10:64726505-64726527 TTTGTTTTTTTTGGGAGAAATGG + Intergenic
1069378610 10:67819465-67819487 TTTGTATTTTTGGTGCAAAAGGG - Intronic
1069517965 10:69094770-69094792 TTTCTCTTTTTTGGTAGAAATGG + Intronic
1070111595 10:73492394-73492416 TTTAAGTATCTGGGGAAAAAAGG + Intronic
1070189991 10:74103299-74103321 TTACAGCATTTGGGGAAAAAAGG - Intronic
1072284454 10:93899545-93899567 TTTGTCTCTTTGGGCAAAAAAGG + Intronic
1072418551 10:95269907-95269929 TTTGTGTTTTTGTAGAAACAGGG + Intronic
1073273778 10:102290100-102290122 TTTGTGTTTTTGTTGAGAAAGGG - Intronic
1073514381 10:104063938-104063960 TTTTTGTTTTTAGGAAAAACAGG + Intronic
1073810355 10:107145780-107145802 TTTCTGATTTGGGAGAAAAGAGG + Intronic
1074307990 10:112296755-112296777 TGTCTGTTTCTGAGGGAAAAGGG + Intronic
1074468827 10:113708280-113708302 TTTTTTTTTTAGGGGAAAGAGGG + Intronic
1074642676 10:115405419-115405441 CTTCTGGTTTTATGGAAAAATGG + Intronic
1075265256 10:120995630-120995652 TTTCTTTGTTTGGGAAAATAAGG + Intergenic
1075509519 10:123059596-123059618 TTTGTGTTTTTGTGTAGAAAAGG - Intergenic
1075613107 10:123869338-123869360 TGTTTGTTTTAGGGGAGAAATGG - Intronic
1076220754 10:128731451-128731473 TTTGTGTTTGAGGGGAGAAAGGG + Intergenic
1076284613 10:129281169-129281191 TTTCTATTTGAGGGGAAAATAGG - Intergenic
1077738459 11:4817625-4817647 TTCATATTTTGGGGGAAAAATGG + Intronic
1078606697 11:12783538-12783560 TTTCAGTTTTGGGGGAAACCTGG + Intronic
1079067707 11:17311625-17311647 TTTATATTTTTGGAAAAAAATGG + Intronic
1079240753 11:18720870-18720892 CTTCTGTCTGTGGGGAAAAAAGG + Intronic
1079382593 11:19951112-19951134 TGACTGGCTTTGGGGAAAAAGGG + Intronic
1079658998 11:23017379-23017401 TCTCTGTATCTGGGCAAAAAAGG + Intergenic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1079994103 11:27277071-27277093 TTATTTGTTTTGGGGAAAAAAGG - Intergenic
1080593114 11:33740757-33740779 TAACTGTTCTTGGGGGAAAATGG + Intergenic
1081191696 11:40111807-40111829 TTGCAGGTTTTGGGGATAAAGGG - Intergenic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1081480393 11:43481807-43481829 TTTTTGTTGTTGGGGAATAGGGG + Intronic
1081523336 11:43904495-43904517 TTACAGGTTCTGGGGAAAAAAGG - Intronic
1081846238 11:46242619-46242641 TTTCTCTCTTTGAGGAAGAATGG + Intergenic
1082998270 11:59269550-59269572 TTCCTGTTTCTGGGAAACAAAGG + Intergenic
1083010318 11:59391073-59391095 ATTATGTTTTTGAGGACAAACGG - Intergenic
1083979884 11:66158526-66158548 TTTCTGTTTTTGTAGAGACAGGG - Intronic
1084327277 11:68408257-68408279 TTTTTTTTTTTGGGGAGACAGGG + Intronic
1084344492 11:68536292-68536314 TTTGTTTTTTTGTGGAAACAGGG + Intronic
1084718239 11:70887620-70887642 CTTCTGTGTTTGGGAAACAAAGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1085008452 11:73116940-73116962 TGATTTTTTTTGGGGAAAAATGG - Intronic
1085232620 11:74985753-74985775 TTTTTGTTGTTGGGGCAAAGTGG - Intergenic
1085608776 11:77927465-77927487 TTTCCTTTTTTGGGGAAGATGGG - Intronic
1085735771 11:79037693-79037715 TTTCAGTTATTTGGGAGAAAAGG - Intronic
1085891849 11:80588957-80588979 TTGCTGTTTTTAGTGATAAATGG + Intergenic
1086201444 11:84207946-84207968 TTTCTTTACATGGGGAAAAAAGG + Intronic
1086439191 11:86811620-86811642 TTACTGTTTTTGGACCAAAAAGG + Intronic
1086873494 11:92067564-92067586 TTTTTATTAGTGGGGAAAAAAGG - Intergenic
1087041773 11:93808190-93808212 TTTCTATTTTTGTGGAGACAGGG - Intronic
1087282133 11:96222945-96222967 CTTCAGTTTTCTGGGAAAAAAGG - Intronic
1087517730 11:99185732-99185754 TTTTTCTCTTTGGTGAAAAAAGG + Intronic
1087522767 11:99263575-99263597 TTCTTGCTTTGGGGGAAAAAGGG + Intronic
1087789861 11:102394463-102394485 TGTCTGTTCTGGGGGTAAAAAGG - Intergenic
1087888970 11:103514909-103514931 TTTCTCTTTTTGCAGAAAAAGGG - Intergenic
1087967069 11:104429224-104429246 TTTTTTTTTTAGGGAAAAAAAGG - Intergenic
1088122906 11:106390599-106390621 TTTCTCTTTTTGGTACAAAAAGG - Intergenic
1088304443 11:108393174-108393196 TTGCTATTCTTGGGGAACAAGGG - Intronic
1088476824 11:110249422-110249444 TTTCTGTTTTAGGGGCAAATGGG - Intronic
1088790616 11:113223079-113223101 TTCATATTTTTGGGGAAAAAAGG + Intronic
1088838785 11:113604447-113604469 TTTCTTTTCTTGGAGAACAAAGG - Intergenic
1089234597 11:117012608-117012630 TTTCTATGTATGGAGAAAAATGG - Intronic
1089442079 11:118525794-118525816 TTTTTGTTTTTAAGGAAAAGCGG + Exonic
1089644695 11:119871081-119871103 TTTCTGTGTTTGAGGAGCAAAGG + Intergenic
1089947411 11:122491412-122491434 CTTCTGTTTCTTGGGTAAAAAGG + Intergenic
1090301429 11:125643780-125643802 TTTCTTTTTTAGGGGCAAAAAGG + Exonic
1091118126 11:133033959-133033981 TTACTGTTTTTGGAGACAAATGG - Intronic
1091178812 11:133584713-133584735 TTTTTTTTTTTGGAGAAGAATGG - Intergenic
1091566710 12:1654165-1654187 TTTTTTTTTTTGTGGAAACAGGG - Intergenic
1091969720 12:4776303-4776325 TTTCTGATTTTTGGGAACATTGG + Intronic
1092044426 12:5419873-5419895 TTTCTTTTTTTGTGGAGACAGGG + Intergenic
1092097569 12:5856173-5856195 ATTATGTTTTTGGTGAAAGATGG + Intronic
1092216554 12:6688118-6688140 TTTCTGGTTTTGGGGGAGAAGGG - Intronic
1092492955 12:8962707-8962729 TTTTTTTTTTTTGGGAAACAGGG - Intronic
1093272107 12:17076423-17076445 TCTCTCTTTTTGAGGAAAAGTGG - Intergenic
1093325232 12:17766317-17766339 TTGCTGTTTATTGGGACAAATGG + Intergenic
1093388856 12:18592759-18592781 TTTATGTTGATGAGGAAAAACGG + Intronic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1093674425 12:21920156-21920178 TTCCTGATTTTAGGGGAAAATGG - Intronic
1094237052 12:28180385-28180407 ACTGTGTTTTTGAGGAAAAAAGG - Intronic
1094256131 12:28428563-28428585 TTTTTTTTTTTGGGGAGAGACGG - Intronic
1094710167 12:32954529-32954551 TTTTTTTTTTTGTGGAAACAGGG - Intergenic
1095304414 12:40622793-40622815 TTTTTGTTTTTGTAGAGAAAGGG - Intergenic
1095351304 12:41216783-41216805 TTTCTTTTTTTTAGGAAATATGG + Intronic
1096047847 12:48580094-48580116 TTTTAGATTTTGGGGAAATAAGG - Intergenic
1096449776 12:51728721-51728743 TTTTTTTTTTTTGGGAAACAGGG - Intronic
1096879172 12:54653599-54653621 TTTAAGTGTTGGGGGAAAAAAGG - Intergenic
1096890083 12:54760690-54760712 TTTGTGTTTTTGTGGAAGCAGGG + Intergenic
1097300131 12:58009170-58009192 TTTTTGTTTTTAGAGAATAATGG + Intergenic
1098040122 12:66345586-66345608 ATTGTGTTTTTATGGAAAAAAGG - Exonic
1098428915 12:70397713-70397735 TTTAGTTTTTTGGGGAGAAATGG - Intronic
1098511649 12:71321259-71321281 TTTCTGTTTTTTTAAAAAAATGG - Intronic
1098522588 12:71450478-71450500 TTTCTTTTTTTGGTAAAAATGGG + Intronic
1098646115 12:72903495-72903517 TTTTTTTTTTTTTGGAAAAAGGG + Intergenic
1098951914 12:76648495-76648517 TTTCTCTTTTTCAGAAAAAAAGG + Intergenic
1099274493 12:80557975-80557997 TGTCTTTTTCTGGGTAAAAAAGG - Intronic
1099593750 12:84629861-84629883 TTTTTGTTATTCGGGAAAGAGGG - Intergenic
1099594823 12:84647587-84647609 TTTCTAATTTTGAAGAAAAATGG + Intergenic
1099981155 12:89604835-89604857 GTTCTGTTGTTGGGGGGAAAGGG - Intronic
1100512297 12:95287472-95287494 TTTGTATTTTTGGTGAAAAAGGG + Intronic
1100649787 12:96572771-96572793 TTTCTATTTTGGGGTAGAAATGG + Intronic
1100994322 12:100286458-100286480 TTTCTTTTTTTCAAGAAAAAAGG - Intronic
1101023878 12:100581653-100581675 GTTCTTTTGTTGGAGAAAAATGG + Intronic
1101104423 12:101425873-101425895 TGGCTGGCTTTGGGGAAAAAGGG + Intergenic
1101926368 12:108975175-108975197 TCTCTCCTTTTGGGGAAAATGGG - Intronic
1102079763 12:110088433-110088455 TTTAAGTTTTTGAGGAAACAAGG + Intergenic
1102526637 12:113516595-113516617 TTTCTTTTTTTTTGGAAACAGGG + Intergenic
1103006566 12:117425391-117425413 TTTTTTTTTTTGGGGAGACAAGG - Intronic
1103135674 12:118505295-118505317 TTTTTGTTTTTGTAGAAATAGGG + Intergenic
1103643692 12:122373653-122373675 TTTCATTTCTAGGGGAAAAATGG + Intronic
1103808750 12:123595854-123595876 TTTCTGTTTTTGTAGAGAAAGGG - Intronic
1103808939 12:123598368-123598390 TTTTTCTATTTGGGAAAAAAGGG + Exonic
1104455684 12:128910275-128910297 TTTTTTTTTTTGGTGGAAAAAGG + Intronic
1104585932 12:130047990-130048012 TTTCTTTTTTTAAGGAAAACAGG + Intergenic
1104706208 12:130949433-130949455 TTTCTTTGTTGTGGGAAAAATGG + Intergenic
1105162580 13:17458014-17458036 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105165466 13:17503386-17503408 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105165926 13:17510697-17510719 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105167629 13:17537561-17537583 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105168880 13:17557285-17557307 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105170674 13:17585500-17585522 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105171747 13:17602148-17602170 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105183494 13:17784863-17784885 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105186399 13:17830223-17830245 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105190315 13:17891095-17891117 TTGATGTCTTTGGGGAAAAAGGG + Intergenic
1105191160 13:17904019-17904041 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105297356 13:19100113-19100135 TTTCTTTTCTTGGGGGAAATTGG - Intergenic
1105639185 13:22244645-22244667 CTTCTGGTTTGGGGGAAAACTGG - Intergenic
1105812041 13:24004127-24004149 TCTCTGTCTTTGGTGAAACACGG + Intronic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1107030155 13:35842496-35842518 TTTTTGTTTTTGGAGAGACAGGG - Intronic
1107194024 13:37625521-37625543 ACTCTGATTTGGGGGAAAAATGG + Intergenic
1107237942 13:38195860-38195882 TGTCTGTTTTTTGGTAACAAAGG + Intergenic
1107605586 13:42052445-42052467 TTTTTGTCTTTGGGAAATAAAGG - Intronic
1107827301 13:44339991-44340013 TTTCTTCTTTTGGGAAAAAGTGG - Intergenic
1107839291 13:44439047-44439069 TTTCTGTTTATGTTGAAGAACGG - Intronic
1108268466 13:48735188-48735210 TGTGTGTTTTAGGGGAAAGAGGG + Intergenic
1108291750 13:48968689-48968711 TTTTTGTTTTTTTGGAAACAGGG + Intergenic
1108552548 13:51560926-51560948 ATTCTGTCTCTAGGGAAAAAGGG - Intergenic
1109133658 13:58620500-58620522 TTTTTGCATTAGGGGAAAAAAGG + Intergenic
1109275653 13:60300863-60300885 TGACTTTTTTTGGGCAAAAATGG + Intergenic
1109661063 13:65461444-65461466 TTTTTTTTTTTCAGGAAAAATGG - Intergenic
1109852081 13:68078384-68078406 TTTCTGTATTTGTGGAGTAAAGG + Intergenic
1109880782 13:68471991-68472013 TTTCTGTCTTTGGGGGATAAAGG - Intergenic
1109914495 13:68963034-68963056 TTGTTGTTTTTGGGGGAACAGGG - Intergenic
1110427329 13:75383314-75383336 TTTTTGTTGTTGGGGAGACAAGG - Intronic
1110540741 13:76704167-76704189 TTTATGATAATGGGGAAAAATGG + Intergenic
1110577960 13:77082150-77082172 TTTTTGTTTTTGAGAAATAAAGG + Intronic
1111210517 13:85072760-85072782 TGTGTGTTTGTGGAGAAAAATGG + Intergenic
1111249358 13:85583358-85583380 ATTGTGTTTTTGGAAAAAAAAGG + Intergenic
1111576420 13:90160352-90160374 ATTCTGAATTTGAGGAAAAATGG - Intergenic
1111675058 13:91376704-91376726 TTTCTTTTTTTGTAGAAAGAGGG - Intergenic
1111781178 13:92726879-92726901 TTTTTGTTTATGGAGAAAAGAGG + Intronic
1111977207 13:94978682-94978704 GTTTTGTTGTTGGGAAAAAAGGG - Intergenic
1112448241 13:99486614-99486636 TCTCTGCTTTTAGGTAAAAAGGG + Intergenic
1113119885 13:106914928-106914950 TTTGTGTTTTTGTGGAGACAGGG - Intergenic
1114230290 14:20775317-20775339 TTTCTCTTTCTGGTGAAGAAAGG + Intergenic
1114518439 14:23317269-23317291 TTTCTATTTTTGTGGAGACAAGG - Intronic
1114554648 14:23554990-23555012 TTTATTTTTTTGGGGACAGATGG + Intronic
1114738226 14:25065163-25065185 TTTCTGTTTTTCTGTAAAGATGG + Intergenic
1114949077 14:27724259-27724281 TTTGTGTTTTTTTGGAGAAAGGG - Intergenic
1115030437 14:28786947-28786969 TTTGTGTTTTTGGTAAAAACGGG + Intronic
1115094444 14:29618058-29618080 TTTTTGTTTTTTGGGAGAAGGGG - Intronic
1115522670 14:34248529-34248551 TTTCTATTATTGTGGAAGAAAGG + Intronic
1115547220 14:34475049-34475071 TTTCTGTTTTTTTGGAGACAGGG - Intergenic
1115837646 14:37426913-37426935 TTTTTGTTTTAGGAGAAACATGG - Intronic
1116337775 14:43679918-43679940 CATCTGTTGTGGGGGAAAAAGGG + Intergenic
1116510086 14:45734333-45734355 TTTCTGTGTTTGGACAAAATAGG + Intergenic
1116513175 14:45771685-45771707 TTTTTTTTTTTAGAGAAAAATGG + Intergenic
1116696604 14:48185260-48185282 TTTTTGCTTTTGGTGAGAAAAGG + Intergenic
1116920612 14:50569180-50569202 TTTTTTTTTTTGTGGAGAAAGGG - Intronic
1117051818 14:51867801-51867823 GTTTTTTTATTGGGGAAAAAAGG - Intronic
1117156248 14:52945077-52945099 TTTCTGTTTTTCTGTAGAAACGG + Intronic
1117701398 14:58417294-58417316 TTTCTTTTTTTGGAGAGAGAAGG - Intronic
1118023545 14:61744504-61744526 TTTTTTTTTTTGGTGAAACACGG - Intronic
1118137014 14:63040947-63040969 TTTTTCTTTTTGGGGAAAAAAGG - Intronic
1119358559 14:74028057-74028079 TATCTATTTTTGAAGAAAAAGGG - Intronic
1119801528 14:77449492-77449514 ATGCTGTCTTTGGGGAAGAACGG - Intronic
1119834970 14:77740923-77740945 TTTCTGTTTTTGGGAGAGACGGG - Intronic
1120219695 14:81718432-81718454 TGGCTGTCTTTGGGGAGAAAGGG + Intergenic
1120603444 14:86541555-86541577 TTTGTGTTTCTGGGTAAAATGGG - Intergenic
1120758875 14:88268588-88268610 TTCCTATTTTTTGGGATAAAAGG - Intronic
1120824678 14:88944669-88944691 TTTCTGTTTTAGGAGACAGATGG + Intergenic
1120879161 14:89401268-89401290 TTTCTGTTTTTAGTGAAAACGGG - Intronic
1120987666 14:90348132-90348154 TTTCTATTTTTTGGTAAAGACGG - Intergenic
1121029716 14:90647515-90647537 TTTGGGTTTTTGGTGAAAAAAGG + Intronic
1121039763 14:90736270-90736292 TTTCTGTTTTTTTAAAAAAAGGG + Intronic
1121506207 14:94479449-94479471 TTTATGAATTTGGGGAGAAATGG - Intronic
1122194251 14:100073326-100073348 TTTTTTTTTTTGGGGAGACAGGG + Intronic
1122529136 14:102412922-102412944 TTTATGTTTTTTGGTAGAAATGG - Intronic
1122545513 14:102519845-102519867 TTTTTATTTTTGTGGAAACAGGG + Intergenic
1122699984 14:103581877-103581899 TTTCTGTCTGTGGGAATAAAGGG + Intronic
1124156255 15:27227317-27227339 TTTCTGTTTTTGGAGGAGACAGG - Intronic
1125036059 15:35125070-35125092 TTACTATTTTTGGTGAATAAAGG - Intergenic
1125823217 15:42651637-42651659 TTTTTTTTTCTGGGGTAAAAAGG + Intronic
1125911856 15:43447236-43447258 TTTTTGTTTTAGGGAAAATAGGG - Intronic
1126003048 15:44229979-44230001 TTTTTTTTTTTTGAGAAAAAAGG - Intergenic
1127374921 15:58375443-58375465 TGTCTGCCTTTGGGGAAAAGGGG + Intronic
1127742754 15:61928707-61928729 TTTTTGTTTTTCGGTAAACATGG - Intronic
1127939286 15:63677594-63677616 GTTTTGTTTTGGGGAAAAAATGG - Intronic
1128038648 15:64550123-64550145 TTTCTGTTTTTTTGTAGAAATGG + Intronic
1128738015 15:70064464-70064486 TCTCTCTCTTTGGGGAAAGAAGG + Exonic
1129454332 15:75668527-75668549 TTTCTGTTTTTTGGTAGAGACGG - Intergenic
1130208042 15:81896400-81896422 TTTCAGTTTTTGGAGATCAATGG - Intergenic
1130997975 15:88914701-88914723 TTTCTTTTTTTGTAGAAACAGGG - Intergenic
1131203518 15:90421511-90421533 GCTCTATATTTGGGGAAAAAAGG + Intronic
1131444261 15:92483366-92483388 TTTCTGTTTTTTGGTAGAGATGG - Intronic
1131554992 15:93389796-93389818 TTTTTTTTTTTGGAGAGAAAAGG + Intergenic
1131788081 15:95934539-95934561 TTTCTGTTTTTGTAGAGACAAGG + Intergenic
1131930970 15:97440730-97440752 ATTCTGTTTTTCTGAAAAAATGG + Intergenic
1132189975 15:99845975-99845997 GTTTTGTTTTTGTAGAAAAAGGG + Intergenic
1133105860 16:3509084-3509106 TTTCTTTTTTTTGGTAAAAATGG - Intronic
1133576915 16:7100453-7100475 ATTCTGTTTTGGAGGAAAATGGG - Intronic
1134108019 16:11497766-11497788 TTTCTGGTTTTTGTGAAAACAGG - Intronic
1134633531 16:15774759-15774781 TTTGTATTTTTGGGGAGACAGGG + Intronic
1134995861 16:18738107-18738129 TTTCTGTTTTTGTAGAGACAGGG - Intergenic
1135238856 16:20784828-20784850 TATATGTTTATGGGGTAAAATGG + Intronic
1135391665 16:22098900-22098922 TTTTTTTTTTTGTGGAAACAGGG - Intronic
1135661076 16:24297077-24297099 TTTCTGTTTTTTGTGGAAACAGG - Intronic
1135906813 16:26519505-26519527 TTTCTGTCTTGGGGAGAAAATGG - Intergenic
1136509993 16:30731687-30731709 TTTCAGTTTTTGAGGAGACAGGG - Intronic
1137235459 16:46613319-46613341 TTTTTGTTTTTTTGGAAACACGG - Intronic
1137236877 16:46624398-46624420 CCTCTGTTTTTGGGGGAACAGGG - Intergenic
1137427917 16:48395334-48395356 TTTCTGTTTTTGGTGGAGACAGG + Intronic
1137832278 16:51555157-51555179 TTTCTGGTTTTGAGGAATGAAGG + Intergenic
1137844050 16:51669501-51669523 TTTCTCTTATTGGGGAAGGAGGG + Intergenic
1138175611 16:54895701-54895723 TTTGTGGCTTTGGGGAAACAAGG + Intergenic
1138296917 16:55894604-55894626 TTACTGTTTTTGTGGAGAAATGG - Intronic
1138464479 16:57178041-57178063 TTTCTTTATTTGGGGATCAAGGG - Intronic
1138486317 16:57346595-57346617 TGTTTGTTTTTGGAGAAACAGGG - Intergenic
1139229099 16:65265317-65265339 CTTCTGCTTTGGGGAAAAAACGG - Intergenic
1139328825 16:66172049-66172071 ATTCTGGTTTGGGGAAAAAATGG + Intergenic
1139718730 16:68835737-68835759 TTTGTGTTTTTGTGGAGACAGGG - Intergenic
1139738189 16:69011458-69011480 TTTTTTTTTTTTTGGAAAAAGGG + Intronic
1139783593 16:69372202-69372224 TTGCTTTTTGTGGGGAAATAGGG - Intronic
1140261218 16:73382104-73382126 TTTCTGTATTTGGTCAGAAATGG - Intergenic
1140262473 16:73392247-73392269 TTTGTGTTTTTGGGTAGAGATGG - Intergenic
1140302743 16:73773963-73773985 TTTATGTTTTTGTAGAAAGAGGG - Intergenic
1140725054 16:77804386-77804408 TTTCTGTTTCTGCTGAAAACTGG + Intronic
1142404280 16:89878447-89878469 TTTTTTTTTTTTAGGAAAAATGG + Intronic
1142719990 17:1769707-1769729 TTTCTGTGTTTGGCCTAAAACGG - Intronic
1142816204 17:2427941-2427963 TTTTTTTTTTTGGGTAAAGATGG - Intronic
1143193614 17:5058615-5058637 TTTTTGTTTGTGTGGAAACAGGG + Intergenic
1143418005 17:6764155-6764177 TTTCTTCTTTTGAGGAAAATGGG + Intronic
1143467292 17:7146063-7146085 TTTCTGATTTTGTGGAGAAGAGG - Intergenic
1143666403 17:8364361-8364383 TTTCTTTTTTTCTGGAAACAGGG + Intergenic
1143674242 17:8419670-8419692 TCTCTTTTTTTGGGGGAAAAAGG + Intronic
1143824297 17:9591705-9591727 TTTCAGTTTTTGTGGAAACAGGG - Intronic
1144085595 17:11805723-11805745 TTTGTGTTTTTGTGGACACAGGG + Intronic
1144354987 17:14436715-14436737 TTTCTTTTTTTGGAAGAAAAAGG + Intergenic
1145103501 17:20096145-20096167 TTTCTTCTTTTGGATAAAAATGG - Intronic
1146487060 17:33251498-33251520 TTTTTATTTTTGTGGAAACAGGG + Intronic
1146732965 17:35211723-35211745 TTTTTATTTTTGGTGAAGAAGGG + Intergenic
1146958944 17:36955933-36955955 TTTCTTTTTTTGTGGAAATAGGG + Intronic
1147127085 17:38378505-38378527 TTTCTTTTTTGGGGGAGACAGGG - Intronic
1147395717 17:40140889-40140911 TTTTTGTTTTTGAGAGAAAAGGG + Intronic
1148010046 17:44471673-44471695 GTTTTGTTTTTAGGGGAAAATGG - Intronic
1148931755 17:51132605-51132627 TTTATGTTTTTGAGGAATAATGG - Intergenic
1149038710 17:52160867-52160889 TTTCTTTTTTTGAGGAGAGAGGG + Intergenic
1149297926 17:55277510-55277532 GTTCTGTTTTCAGGGAAGAAGGG - Intronic
1149501336 17:57154889-57154911 TTTCTGTATTTTAGGGAAAAAGG - Intergenic
1149706973 17:58703950-58703972 TTTTTTTTTTTGGGTAGAAATGG + Intronic
1149802401 17:59582058-59582080 TTTTTTCATTTGGGGAAAAAGGG + Intronic
1149844091 17:59993435-59993457 TTTTTTCATTTGGGGAAAAAGGG - Intergenic
1149886850 17:60348600-60348622 TTTCTGTTTTTGTAGAGACAGGG - Intronic
1150211421 17:63443796-63443818 TTTCTTTTTTTGGAGAGATAGGG + Intronic
1150768987 17:68025472-68025494 TTTTTTTTTTTGTAGAAAAAGGG + Intergenic
1150966824 17:69980186-69980208 TTTTTTTTTTTTGGCAAAAACGG - Intergenic
1151111385 17:71682119-71682141 TTATTCTATTTGGGGAAAAAGGG + Intergenic
1152030023 17:77836453-77836475 TTTTTGTATTTGGGTAAAGACGG - Intergenic
1152428913 17:80236564-80236586 TTTCTGTTGTTTGGGAAAGGGGG + Intronic
1153723165 18:7928058-7928080 CTTCTCTTTCTGGGGAAAATGGG + Intronic
1153897424 18:9579056-9579078 TTTCTGTTTTTGTGAAATCAAGG - Intronic
1154213142 18:12396907-12396929 CTTCTGTTTGTGGGAAACAAAGG - Intergenic
1154336148 18:13466461-13466483 TTTTTTTTTTTGGTGAAACAAGG - Intronic
1154967793 18:21377163-21377185 TTTTTCTTTCTGTGGAAAAAGGG - Intronic
1154971079 18:21410481-21410503 TTTATGTTTTTGGAGAGACAGGG - Intronic
1155108700 18:22692672-22692694 TTTAGGATCTTGGGGAAAAAAGG - Intergenic
1155288448 18:24316088-24316110 TTTGTGTTTTTTGGTAAAGACGG - Intronic
1155354808 18:24941943-24941965 TTTCTTTTTTGGTGGAAGAATGG - Intergenic
1155679233 18:28469298-28469320 TTTATTGTTTTGGGGAAAATAGG + Intergenic
1155791756 18:29980546-29980568 TTTTTTTCTTTGCGGAAAAAAGG - Intergenic
1155826192 18:30446351-30446373 TTATTGTTTTTGAGGATAAAGGG + Intergenic
1156001650 18:32391557-32391579 TTTCTGTCTTTGTGGAAAACTGG - Intronic
1156033267 18:32738000-32738022 TTTCTGTTGTTGGTCACAAAAGG + Intronic
1156590931 18:38487346-38487368 TTTCTGGTTATGGATAAAAAGGG + Intergenic
1156731223 18:40195480-40195502 TTTCTCTTTTTGTGGAGAATGGG - Intergenic
1156777833 18:40814879-40814901 TTACTGTTTTTGTGAAATAATGG - Intergenic
1156934748 18:42690078-42690100 TTTGTGTTTGGGGGAAAAAAGGG + Intergenic
1157844113 18:50986661-50986683 TTTCTGTTGTTCTGGAAAATGGG + Exonic
1158107859 18:53905572-53905594 TTTCTGTTTTTCGTCAGAAATGG + Intergenic
1158191161 18:54830267-54830289 TCACTGTTTTTCTGGAAAAATGG + Intronic
1158207947 18:55014547-55014569 TTTCTGATATTGAGGAAAATAGG - Intergenic
1158241888 18:55386978-55387000 TTTCTGTTCTAGTGTAAAAATGG - Intronic
1158318618 18:56238972-56238994 TTTCTGTTACTGGGGACCAAGGG + Intergenic
1158706417 18:59796267-59796289 TTTGTGTTTTTGGTGGAAACTGG - Intergenic
1159098993 18:63937579-63937601 TTTCTTTTTTTGTAGAGAAAGGG + Intergenic
1159696782 18:71568116-71568138 TCTTTGTTTTTGGTGAAGAAAGG - Intergenic
1159965841 18:74595571-74595593 TTTCTGATTCTAAGGAAAAAGGG - Intergenic
1160467430 18:79092649-79092671 TTTTTTTTTTTGGTTAAAAACGG + Intronic
1161357911 19:3829517-3829539 TTTGTTTTTTTGTGGACAAAGGG + Intronic
1161665252 19:5572018-5572040 TTTTTGTTTTTGAGCAAACAGGG + Intergenic
1162218463 19:9156414-9156436 TTTATGTTTTTGGTGGAACAGGG + Intronic
1162382767 19:10341189-10341211 TTTTTTTTTTTGTGGAAACAGGG - Intergenic
1162663127 19:12186102-12186124 TCTCTGTTTTAGGGAAAAAATGG + Exonic
1162702033 19:12523580-12523602 TTTCTGTTTTTAGTGGAAATAGG + Intronic
1162709625 19:12582900-12582922 CTTGTATTTTAGGGGAAAAATGG - Exonic
1163319588 19:16565975-16565997 TTACTGTTTTTGGAGAGACAGGG - Intronic
1163593245 19:18205745-18205767 TTTCTCTTCCTGGGGAAAAAAGG - Intergenic
1163837235 19:19582294-19582316 TTTCTGTTTTTGTGGCCAAAAGG + Intronic
1164132412 19:22377029-22377051 TTACTCTTTTTGAGGAAAAGTGG - Intergenic
1164185891 19:22869324-22869346 CTACTCTTTTGGGGGAAAAATGG + Intergenic
1164216302 19:23152847-23152869 TTACTCTTTTTGGGGATAAGTGG + Intergenic
1164276904 19:23727243-23727265 TTTCTTTTTTTTAGTAAAAATGG - Intergenic
1164547675 19:29182578-29182600 TTTTTTTTTTTGGTGAAGAAAGG - Intergenic
1164847282 19:31444146-31444168 TATCTGTTTTTGGAGAAAATTGG + Intergenic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165461670 19:35947487-35947509 TTTCTGTTTTTTTGGAGACAGGG - Intergenic
1165536157 19:36447185-36447207 TTTGTATTTTTGAGTAAAAATGG + Intronic
1166034660 19:40159173-40159195 TTTCTTTTTTTGTGGAAATGGGG - Intergenic
1166279594 19:41782758-41782780 TTTTTTTTTTTGGGTAAAGATGG - Intergenic
1166389412 19:42400822-42400844 TTTTTGTTTTTTTGGAAACAGGG + Intergenic
1166458904 19:42968819-42968841 TTTATGGCTTTGGGGAAAAGGGG + Intronic
1167024861 19:46908033-46908055 TTTCTGTCAATGGGGAAAAATGG - Intergenic
1167034630 19:46987758-46987780 TATTTGTTTTTTGGTAAAAATGG - Intronic
1167122340 19:47525378-47525400 TTTGTTTTTTTTGGTAAAAATGG + Intronic
1167568164 19:50270038-50270060 TTTTTGTTTTTGTAGAGAAAGGG - Intronic
1167682766 19:50934969-50934991 TTTCTATTTTTGGGTAGAGATGG - Intergenic
1168197564 19:54786843-54786865 TAACTGTATTTGGGGTAAAAGGG + Intronic
925861898 2:8186675-8186697 TTTCTGACCTGGGGGAAAAATGG + Intergenic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
926767086 2:16330942-16330964 TGTCTGTCTTTGGGAAAAGAAGG + Intergenic
926802486 2:16671354-16671376 CTTCTCTTTTTGGGGGAGAAAGG - Intergenic
926983249 2:18593917-18593939 TTTGTTTCTTGGGGGAAAAAAGG - Intergenic
927002194 2:18809313-18809335 TTTCAGATTTAGGGGAAAAATGG - Intergenic
927049768 2:19315624-19315646 TTTTTTTTTTTTGGTAAAAAAGG - Intergenic
927346860 2:22054408-22054430 TTTCTTTTTTTTAGGAAAAATGG + Intergenic
927670025 2:25061281-25061303 TTTCTGTTTTTTGGTAGAGACGG + Intronic
927823364 2:26288700-26288722 TTTCTGTTTTTTTTGAAACAGGG - Intronic
927946173 2:27136638-27136660 TTTTTGTTTTTGGAGAGACAGGG + Intergenic
928064972 2:28154405-28154427 TTTCTGATTTTAGGGGAACAGGG + Intronic
928601153 2:32904752-32904774 TTTCTGTTATAGAGGATAAAGGG + Intergenic
928793328 2:34985353-34985375 TGTGTGTTTTGGGGGAAAAAAGG + Intergenic
929008344 2:37416988-37417010 ATTTTATTTTTGGGAAAAAATGG + Intergenic
929744888 2:44646660-44646682 TTCATGGTTTTGGGGAAAAAGGG - Intronic
930138121 2:47923113-47923135 TGGCTGTTTTGGGGGTAAAAAGG + Intergenic
930364815 2:50425886-50425908 TTTCTGTTTTTGAAGAATACCGG - Intronic
930584222 2:53250688-53250710 TTTCTGATGTTGGAGAGAAAAGG + Intergenic
930717557 2:54607069-54607091 TTTCTTTTTTTGGGGTAAGGAGG + Intronic
930739968 2:54821988-54822010 TCCCTCTTTTTGTGGAAAAAAGG - Intronic
931340313 2:61394944-61394966 TGTTTGTTTTGTGGGAAAAATGG - Exonic
931412856 2:62050488-62050510 TTGCTTTTGTTAGGGAAAAAGGG + Intronic
931479513 2:62626658-62626680 TGTGTGTTTCTGTGGAAAAATGG - Intergenic
931516770 2:63054720-63054742 TTTCTGTTTTTGAGATGAAAGGG + Intronic
931686530 2:64798809-64798831 GTACTTTTTTTGGGGAAAAAAGG + Intergenic
932355310 2:71063525-71063547 TTTCTGCTTTTAGGGAAGAGTGG + Intergenic
932358037 2:71082718-71082740 TTCCTGTTTCTGGGCAAAACTGG - Intergenic
932855795 2:75232804-75232826 TTTCCTTCCTTGGGGAAAAAAGG + Intergenic
932930131 2:76026157-76026179 TTTCTATTTCTGTGAAAAAATGG - Intergenic
933400345 2:81788602-81788624 TTTTTGTTTTTGTAGAAATAGGG - Intergenic
933420187 2:82035148-82035170 ATTCTTTTGTTGGGAAAAAAAGG + Intergenic
933855480 2:86409828-86409850 TTTTTGTTTTTGTAGAAAAGGGG - Intergenic
934591797 2:95559514-95559536 TTTCTGTTTTTTGTGAATAGAGG + Intergenic
934725101 2:96611444-96611466 TTACTATTTGTGGAGAAAAATGG - Intronic
934863002 2:97780011-97780033 TTTTTGTTTTTTTGGAGAAAAGG - Intronic
935138024 2:100324566-100324588 GTTCTTTTTATGGTGAAAAAGGG - Intergenic
935408366 2:102733742-102733764 TTTTTTTTTTTGGAAAAAAATGG - Intronic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935503832 2:103874011-103874033 TTTCCATCTTTGGGGATAAATGG + Intergenic
935535663 2:104290911-104290933 TTTCTTTTTTTAGGGAAAAGTGG - Intergenic
935900265 2:107784031-107784053 TATCTCTTTTTGGAGAAAACAGG - Intergenic
936466030 2:112751188-112751210 TTTCAGTTTATAGGGCAAAAAGG + Intronic
937025994 2:118697680-118697702 ATTCTATTTTTGGGAAAAAATGG - Intergenic
937604986 2:123789106-123789128 TATTTGTTTTTGTTGAAAAATGG + Intergenic
938106912 2:128537980-128538002 TTACTGGTTTTGGAGAAAACAGG - Intergenic
938172727 2:129094997-129095019 GTTTTGATATTGGGGAAAAATGG + Intergenic
938548584 2:132358740-132358762 TTTTTGTATTTGGTGAAATATGG - Intergenic
939322584 2:140643156-140643178 TTTCTGTATTTAAGAAAAAAGGG - Intronic
939407956 2:141784197-141784219 TTTCCACTTTGGGGGAAAAAAGG - Intronic
939492442 2:142892713-142892735 TTTCTGTTTTAGGTGAATAGTGG + Intronic
940053599 2:149490157-149490179 TTTTTTTTTATGAGGAAAAATGG + Intergenic
940682115 2:156799858-156799880 GCTCTGATTTTGAGGAAAAAGGG + Intergenic
941281373 2:163555851-163555873 TCTCTGTTTTTTGGGAAGAAAGG - Intergenic
941336230 2:164246956-164246978 TTTCTGTTCTTTGAGAAATAAGG - Intergenic
941707318 2:168673498-168673520 TTTGTCTTTTGGGAGAAAAATGG + Intronic
942106530 2:172639208-172639230 TTCCTGCTTTTGGAGCAAAAGGG + Intergenic
942187504 2:173438362-173438384 TTTCCCTTTTTTGGGAAAAATGG - Intergenic
942280821 2:174362297-174362319 TTTTTGTTTTTGTTGAGAAAAGG - Intronic
942473957 2:176294834-176294856 ATACAGTTTTTGGGGAAAAACGG + Intronic
942768589 2:179487299-179487321 TGACTGTTGTTTGGGAAAAATGG + Intronic
943698387 2:190961574-190961596 TATCTGTCTTTCTGGAAAAATGG - Intronic
944671972 2:202002461-202002483 TTTCTGTTTGGGGGGCAATAAGG - Intergenic
945155966 2:206838099-206838121 TTTCTATTTTTGGAGATCAATGG - Intergenic
945407291 2:209464806-209464828 TTTCAGTTTTGGGGGAACACAGG - Intronic
945718596 2:213388891-213388913 TTTATGTTTTTGCAAAAAAAAGG - Intronic
945851222 2:215010042-215010064 TTTCTGCTTTTTGAGATAAATGG + Intronic
945951273 2:216041142-216041164 TTTCAGTTTTTGAGGAAAGCGGG - Intronic
947779634 2:232746580-232746602 TATATTTTTATGGGGAAAAAGGG - Intronic
947845797 2:233242766-233242788 TTTCTGTTTAGGGGGAAAAGAGG + Intronic
947879242 2:233490880-233490902 TTTATTTTTTTAGGGAAACATGG - Intronic
948070418 2:235116987-235117009 TTTCTGGTTTTGCAGAAAGAAGG - Intergenic
948500660 2:238390958-238390980 TTTTTCTTTTTTGAGAAAAAAGG + Intronic
1168796834 20:615962-615984 TTTCTGTTAGTGAGGAAGAAGGG + Intergenic
1169387107 20:5159652-5159674 AATCTGTTTTGGGGGAAAAGAGG - Intronic
1169646449 20:7815355-7815377 TTTTTGTTTTTGAGTAAAGACGG + Intergenic
1169759710 20:9078151-9078173 TTTCTGTTTTTGTAGAGACAGGG + Intronic
1170235427 20:14098706-14098728 TTTAAGTTATTGGGGAAATAAGG + Intronic
1170396491 20:15931467-15931489 TTTATTTTTTTGGAGAGAAAGGG - Intronic
1170450229 20:16475478-16475500 TTTCTGTTTCTGTGTAAACAAGG + Intronic
1170916405 20:20630898-20630920 TTTTAGTTTGTGGGGAAAATGGG - Intronic
1171559613 20:26111387-26111409 TTTTTTTTTTTTGGGAAAAGTGG + Intergenic
1171877410 20:30591241-30591263 TTTTTGTATTTGGTGAAATATGG - Intergenic
1172198807 20:33111181-33111203 TCTCTTATTTTGGGGAATAAGGG + Intronic
1172593897 20:36136350-36136372 TTTTTTTTTTTGGAGAAACAGGG + Intronic
1173076027 20:39820515-39820537 TTTTTTTTTTTGGAGAAACAGGG - Intergenic
1173328078 20:42051635-42051657 CTTCTAATTTTGGGGAACAAGGG + Intergenic
1173830160 20:46078485-46078507 GTTATGTTTCTGGGGAAAACTGG + Intronic
1174003722 20:47393619-47393641 TTTCTTTTTTTGGTAAAGAAAGG + Intergenic
1174022505 20:47542208-47542230 TTTTTTTTTTTGGTGGAAAAGGG + Intronic
1174559314 20:51418572-51418594 TTCCTGAATTTGGGGAAAATTGG + Intronic
1175026481 20:55907858-55907880 TTTCTGTGTTTGTTGGAAAAGGG - Intergenic
1175063665 20:56266887-56266909 TTTGTGTTTTTGTGGAGACAGGG + Intergenic
1175080528 20:56416611-56416633 ATCATGTTATTGGGGAAAAAAGG - Intronic
1175647703 20:60689104-60689126 TTTGTGTTTTATGGGAAGAATGG - Intergenic
1176165190 20:63669207-63669229 TTTCTGGTTTTCTGAAAAAATGG + Intronic
1176253005 20:64134534-64134556 TTCCTTTTTTTGGGGGAAATTGG + Intergenic
1177133024 21:17280013-17280035 TCTCTGCCTTTGGGAAAAAAAGG + Intergenic
1177457356 21:21357430-21357452 TTTCTATTTGAGGTGAAAAAAGG - Intronic
1177462404 21:21430198-21430220 TTTTTATTTTTGTGGAAACAGGG + Intronic
1178164129 21:29952571-29952593 TTTCTTTTGTTGGAGGAAAATGG - Intergenic
1178792266 21:35711516-35711538 TATCTGTCTTTGGAGAAAATGGG + Intronic
1178911245 21:36675312-36675334 TTTTTGTTTTTGGAGAGAAGGGG + Intergenic
1179245437 21:39630057-39630079 TTTTGGTTTTTGTGGGAAAACGG + Intronic
1179379404 21:40884352-40884374 TTACTTTTTTTGGGTTAAAATGG + Intergenic
1180560521 22:16611273-16611295 TTTCTTTTTTTGGGGGGCAAGGG + Intergenic
1181762074 22:25065546-25065568 TTTCTTTTTTGGGGGGAAAGAGG - Intronic
1183115149 22:35686083-35686105 ATTGGGTTTTTGGGCAAAAAAGG - Intergenic
1183233273 22:36596475-36596497 TTTTTGTTTTTTGGGAAGGAGGG + Intronic
1184116376 22:42425092-42425114 TTTGTATTTTTGGTGAAGAAGGG + Intronic
1184365369 22:44047748-44047770 TATCTTTTTTTGGGGAAAGAGGG + Intronic
1185196744 22:49476136-49476158 TTTCTTTTTTTAGCTAAAAATGG + Intronic
1185357569 22:50383424-50383446 ATTCTGTATTTGGGAAAACACGG - Intronic
949101276 3:148533-148555 TTCCTGCTTTTGGATAAAAAGGG + Intergenic
949394794 3:3603166-3603188 TTTTTTTTTTTTGGTAAAAAGGG - Intergenic
949558823 3:5184178-5184200 TTTCTGTTTTCAGGAAAAACTGG - Intergenic
949590423 3:5488242-5488264 TTTCTCTTTTTGGAAAGAAAAGG - Intergenic
949919942 3:8992780-8992802 TTTCATTTTGTGGGGAACAAGGG + Intronic
950294466 3:11816763-11816785 TTTCTTTTTTTGGGGGGACAGGG - Intronic
950398187 3:12750145-12750167 TTTTTTTTTTTGTGGAAACAGGG + Intronic
950821186 3:15760711-15760733 TAGCTGAGTTTGGGGAAAAAAGG + Intronic
951037265 3:17947560-17947582 TTTAAGTTCTTTGGGAAAAAAGG + Intronic
951556859 3:23929612-23929634 TTTTTGTTTTTGTAGAGAAAGGG + Intronic
951895917 3:27609599-27609621 TGTCTGGCTTTGGGGAAAAGGGG - Intergenic
951965491 3:28379859-28379881 TTTCTGTTTTGGGGGTCAAAGGG + Intronic
952083401 3:29788207-29788229 TTTTTTTTTTTGGAAAAAAATGG + Intronic
952713853 3:36458296-36458318 TTTCTATTTAAGGGGAAGAAAGG - Intronic
952731430 3:36640550-36640572 TTTTTGTTTTTGCAGAAATAAGG - Intergenic
952770954 3:36999916-36999938 TTTTTGTTTTTGTAGAAATAGGG + Intronic
952891504 3:38045040-38045062 TTTCTCTCTTTGGGTCAAAATGG + Intronic
953119378 3:40025007-40025029 TTTCTTTTTTTGGCAAAGAAGGG - Intronic
953479521 3:43238407-43238429 TTTCTGCTTTTAGTGAAAAAGGG - Intergenic
953890589 3:46749406-46749428 TTTCTGATTTTGGAGAAAAGTGG + Intronic
955243132 3:57198943-57198965 TTTTTGTTTTTAGGGAAAGATGG - Exonic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
955663315 3:61324423-61324445 TTTTTGCATTTGGGGAAAATGGG - Intergenic
955747775 3:62157049-62157071 CTTCTCTGTTTGGGGAAAAAGGG - Exonic
956598063 3:70990312-70990334 TTTCTTTTTTTTAGGCAAAAAGG + Intronic
957068113 3:75543102-75543124 TTTCTTTTTTTGTAGAGAAAGGG + Intergenic
957078833 3:75620606-75620628 TTTCTTTTTTTTGGGAGACAGGG + Intergenic
957150222 3:76476820-76476842 TTTATATTCTTGGGAAAAAATGG + Intronic
957246386 3:77721939-77721961 TAAATGGTTTTGGGGAAAAAAGG - Intergenic
957477423 3:80743320-80743342 TGTATGTTTTTGGGGGAACAAGG + Intergenic
957599112 3:82309089-82309111 TGTGTGCTTTTGGGGACAAAAGG - Intergenic
957800167 3:85067973-85067995 TCTTTGTTTTTGGGGAAGTATGG + Intronic
957837631 3:85618260-85618282 TATCTTTTATTGGGGAAAAAAGG - Intronic
958506580 3:94986155-94986177 TTTCTGTCAAAGGGGAAAAAGGG + Intergenic
958619106 3:96533588-96533610 TTTCTGTTATTGTTGAAAACTGG - Intergenic
958659150 3:97043088-97043110 TTTCTTTCCTGGGGGAAAAAAGG - Intronic
958792060 3:98663147-98663169 TTTCTTTTTTTGTGGAGATAGGG + Intergenic
959182323 3:102997322-102997344 TTTTAGTTTTTGGAGAAACAGGG - Intergenic
959543017 3:107561697-107561719 TATCTGCTTCTGGGGAGAAATGG + Intronic
959628292 3:108479013-108479035 TCTCTGTTTTGGGGGGAAAGAGG + Intronic
959676345 3:109040186-109040208 TTTCTTTTTTTGCCGAAAACTGG - Intronic
960891306 3:122451396-122451418 TATCTGTTTTTGGAGAAACAGGG - Intronic
960975896 3:123173453-123173475 TTTCTGGTTTGGGGGCAAAATGG - Intronic
961749996 3:129089095-129089117 CCTCTGTTTTTGGGGGAACAGGG - Exonic
962324865 3:134424386-134424408 TCTCTCTTTGTGGGGAAAGATGG + Intergenic
962497995 3:135962029-135962051 CTTCTTTTTCTGGGGAAAAGGGG + Intergenic
962626964 3:137235465-137235487 TTTCTGTTCCTTGTGAAAAAGGG + Intergenic
962723582 3:138199374-138199396 TTTCTCCTTTTGGAGAAAATTGG + Intronic
962817886 3:139019491-139019513 TTTCTTGGTTTGGGGAGAAACGG + Exonic
963402660 3:144820643-144820665 TTTCTGTTTTTTGAGAAAGCAGG - Intergenic
963800246 3:149669032-149669054 TTGGTGATTTTGGGTAAAAAAGG - Intronic
963949892 3:151187788-151187810 TTTGTGTTTTTGGAGAAACATGG - Intronic
963997134 3:151722395-151722417 TTTATGTTTTAGTGGAAACAGGG + Intergenic
964049800 3:152376837-152376859 TATCTCTTCTTGGGGAAAATGGG + Intronic
964667593 3:159191137-159191159 TTTCTTTTTTTGGTGGAAACGGG + Intronic
964809652 3:160650474-160650496 TGTCACCTTTTGGGGAAAAATGG - Intergenic
965014754 3:163142643-163142665 ATGCTGTTTCTGGGAAAAAAAGG - Intergenic
965254566 3:166389227-166389249 TTTTTTTTTTTGGAGAGAAAGGG - Intergenic
965494889 3:169385746-169385768 TCTCTGTTATTGGGGAAAATTGG + Intronic
965686003 3:171303498-171303520 TTTCTGTATTTAGTGAAACAAGG - Intronic
966093784 3:176173243-176173265 TTTGTATTTTTGAGGAAACAGGG - Intergenic
966404152 3:179578136-179578158 TTTCTGTTTTTGTAGAGACAGGG - Intronic
966703207 3:182879249-182879271 TTTCTCTTTTTTGTGAAACAGGG - Intronic
966956037 3:184880166-184880188 GTTCTCTTATTGGGGAAAATTGG - Intronic
966964665 3:184978570-184978592 TTTGTGTTTTTGTAGAAACAGGG + Intronic
967333953 3:188321748-188321770 TGTGTGGTTTTGGGGGAAAAAGG - Intronic
967369152 3:188723923-188723945 TTTTTCTTTTTGGGGAAGAGAGG - Intronic
967592753 3:191298115-191298137 TTTTATTTTTTAGGGAAAAAAGG + Intronic
967899603 3:194435942-194435964 TTAGTGTTTATGGGGGAAAATGG + Intronic
968084933 3:195870005-195870027 GTTCTGTTTTTGGGGACAGTGGG - Intronic
968344448 3:197989412-197989434 TTTTTGTATGTGGTGAAAAAGGG + Intronic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
968796157 4:2706197-2706219 TTTTTGTTTTTGTAGAAACAAGG - Intronic
969358228 4:6644042-6644064 TTTTTGTTTTTGGTGAGACAGGG + Intergenic
969888666 4:10239579-10239601 TATCTGCTTTTAGGGACAAAAGG + Intergenic
970129825 4:12855316-12855338 TTTTTGGTTTTTTGGAAAAAGGG - Intergenic
971138170 4:23892995-23893017 TTTCTATTGTTGAGAAAAAATGG - Intronic
971263814 4:25080656-25080678 TTTTTGTTATTGGTGAAATAAGG - Intergenic
971607513 4:28676897-28676919 TTGCTGGCTTTGGGGAAAAGAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972417455 4:38855782-38855804 TTTCTATTTATTGGGAAAAAAGG + Intronic
972425416 4:38928121-38928143 TTTCTGTTTTATGGACAAAATGG - Intronic
972462048 4:39313674-39313696 TTACTGTTTTATGGGAAAAAAGG + Intronic
973325753 4:48859625-48859647 TTTCTTTTTTTGGGAAAAGCTGG + Intronic
973570457 4:52233762-52233784 TTTCTGTTTTTGCTGTTAAATGG + Intergenic
973874661 4:55205594-55205616 TTTCTGTTTCTGGAGCAAAATGG - Intergenic
974674261 4:65070327-65070349 TTTCTTTAGTTGGGGAAGAAAGG + Intergenic
975060702 4:69994779-69994801 TTTATGTTTTTGTGGAGATACGG + Intergenic
975670032 4:76771477-76771499 TTTATCTTTTTGGGAAAGAAAGG - Intronic
976209486 4:82653145-82653167 TTTCTCTTTTTCTGGAAACAGGG - Intronic
976221213 4:82758289-82758311 TTTTTGTTTTTGGAGAGACAGGG - Intronic
976483063 4:85567251-85567273 TTTGTGTTTATGGCTAAAAATGG + Intronic
976501172 4:85791100-85791122 TTTCTTTGTTTGGTTAAAAAGGG - Intronic
976671057 4:87654240-87654262 TTGCTGGCTTTGGGGAAAAGAGG + Intronic
976721765 4:88176165-88176187 TTTCTTTTTTTGTGGAGACAGGG + Intronic
977374021 4:96177630-96177652 TATATGTTTTTTGGGAAGAATGG + Intergenic
977608836 4:99012069-99012091 TTTATTTTTTTGGGTAAAGATGG + Intronic
978329967 4:107601922-107601944 TTTTTGTCTTTGGGAAAATAGGG - Intronic
978346477 4:107775385-107775407 TTTCTTTTTTTGGTGAGACAGGG - Intergenic
978527726 4:109682213-109682235 GTCCTGCTTTTGGGCAAAAAGGG + Intronic
979170398 4:117594855-117594877 TTTTTTTTTTTCTGGAAAAAAGG - Intergenic
979406392 4:120315916-120315938 TCTATATTTTTGGGGAAAAGAGG + Intergenic
979433254 4:120658110-120658132 TATCAGTTTTAGGGGAAGAATGG + Intergenic
979476032 4:121158260-121158282 TTTCTCTATTTGTGGAAAATAGG + Intronic
979858328 4:125662479-125662501 TTTTGTTTTTTGGGGAAAAATGG - Intergenic
980919215 4:139065503-139065525 TTTCTGGTTTTAGGGAAAACAGG + Intronic
981097998 4:140801098-140801120 TTTCTTCATTTTGGGAAAAATGG + Intergenic
981633905 4:146853213-146853235 TTTCTATTTTTGGGGGAGATTGG - Intronic
981732323 4:147912660-147912682 TTTTTTTTTTTGGGGAGACAGGG + Intronic
981803297 4:148682918-148682940 TTTCTGATATTGGTGGAAAAAGG + Intergenic
981982296 4:150808924-150808946 TTTTTGTATTTGGGGCATAAGGG - Intronic
982201288 4:152963470-152963492 TTTTTGTTTTTAGGCAAATAAGG + Intronic
982736184 4:159009317-159009339 TTTCTGTTTTAGGAGATATAAGG - Intronic
983075642 4:163322990-163323012 TTTCTGCTTTTGGGGACAAATGG - Intergenic
983315226 4:166123549-166123571 TATATTCTTTTGGGGAAAAAGGG - Intergenic
983319676 4:166180073-166180095 TTTTTTTTTTTTGGTAAAAATGG - Intergenic
983388868 4:167102959-167102981 TTTCTGCTTGAGGGGAAAAGGGG + Intronic
983662201 4:170140220-170140242 TTCCTGTTTATGGGGCAGAATGG + Intergenic
983688710 4:170441090-170441112 TTTCTGTTTCTGCGGACACAGGG + Intergenic
983804196 4:171973230-171973252 TGTCTTCTTTTGGAGAAAAAAGG + Intronic
984047929 4:174825120-174825142 TTGCTATTTTCAGGGAAAAAGGG + Intronic
984189355 4:176586789-176586811 ATCCTTTTTTTGGGAAAAAAAGG + Intergenic
984201648 4:176728697-176728719 ATTCTATTTTAGGGGAAATATGG - Intronic
984241558 4:177225956-177225978 TGGCTGCCTTTGGGGAAAAAGGG - Intergenic
984277928 4:177633030-177633052 TTCTTCTTTTTGGAGAAAAATGG - Intergenic
984280590 4:177665885-177665907 TTTGGATTTTTGAGGAAAAAGGG + Intergenic
984363976 4:178774490-178774512 TTTCTATTTTTGGGAAAGACGGG - Intergenic
984733025 4:183086061-183086083 TTTCTATTTTTTGGTAGAAATGG - Intergenic
984844233 4:184096502-184096524 TTTTTGTTTTTGGGAGAAGAGGG + Intronic
984940841 4:184930891-184930913 TTTGTGTTTTTGTAGAAACAGGG + Intergenic
985050398 4:185985421-185985443 TTTCTGTTTTTGTAGAGACAGGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985230773 4:187814258-187814280 TGTCAGTTTTTTGGGAAATATGG - Intergenic
985264955 4:188148772-188148794 TTTATGTTTTTGTAGAAACAGGG + Intergenic
985814696 5:2117951-2117973 TTCCTGGATTTGGGGGAAAATGG + Intergenic
986035495 5:3933261-3933283 TTCCTGTTTTTGCAGAACAAAGG + Intergenic
986697389 5:10369910-10369932 TTTCTAGTTTTGGGGAATTAAGG + Intronic
986908463 5:12524142-12524164 TTTCTGTTTTTGATGAATACTGG + Intergenic
987227160 5:15854087-15854109 TTTCTGTCTTTAGAGAGAAATGG + Intronic
987546888 5:19322049-19322071 TTTCTATTTTTTGGTAAAGATGG + Intergenic
987741323 5:21912812-21912834 TGGCTGGCTTTGGGGAAAAAGGG + Intronic
987820914 5:22965366-22965388 TTTTTGTTTATGCTGAAAAAGGG + Intergenic
988419526 5:30988520-30988542 TTTGTGGTTTTGGGGAGCAATGG + Intergenic
988446398 5:31290661-31290683 GTTCTTTTCTTGGGAAAAAAAGG - Intronic
988722894 5:33896172-33896194 TTCCTGTCTATGGGAAAAAATGG - Intergenic
989736853 5:44717977-44717999 TTTCTTTTTCTGGAGAAAGAAGG - Intergenic
989993234 5:50794651-50794673 TTTTTGCTTTTCAGGAAAAATGG + Intronic
990388894 5:55298526-55298548 CATCTTTTTTGGGGGAAAAAAGG + Intronic
990861119 5:60328840-60328862 CTCCTGTTTTCAGGGAAAAAAGG - Intronic
990943180 5:61224486-61224508 TTTCTCTTTTTTGTGAAAATAGG + Intergenic
991493001 5:67201527-67201549 GTCCTGTTTTTAGGTAAAAATGG + Intergenic
991771340 5:70043761-70043783 TTTTTCTTTTTGTGGAAACAGGG - Intergenic
991850632 5:70919178-70919200 TTTTTCTTTTTGTGGAAACAGGG - Intergenic
991932217 5:71765206-71765228 TTTCTTTTTCTTGGGAAACATGG - Intergenic
992272589 5:75080814-75080836 ATACTGTTTTTGGGGAAATAAGG - Intronic
992759564 5:79939497-79939519 TTGCTGTTTTTGTGAAATAAAGG + Intergenic
993394421 5:87365970-87365992 TTTCAGTTTTAGGTGAGAAATGG + Intronic
993764599 5:91840534-91840556 TTTCTGTTTTATTGGAAAAAAGG - Intergenic
994422845 5:99543792-99543814 TTTTTGTTTTTGAGAGAAAATGG + Intergenic
994579710 5:101625335-101625357 TTTCTCTTTTTGTGGAGAACGGG - Intergenic
995072769 5:107943324-107943346 TTTCTGTTTGTGGGGGAAGATGG - Intronic
995460879 5:112401663-112401685 TTTCTGTTGTAGGAGGAAAAAGG - Intronic
995576004 5:113535082-113535104 TTTATATTTTGTGGGAAAAAAGG + Intronic
995695486 5:114874435-114874457 TTCCTATTTTTGGGAAATAAAGG + Intergenic
996121388 5:119677178-119677200 ATCCTGTATCTGGGGAAAAAAGG - Intergenic
996365726 5:122698922-122698944 TTTTTGTTATACGGGAAAAAGGG - Intergenic
996457963 5:123706925-123706947 TTACTTTTTTTGAGAAAAAATGG + Intergenic
996847880 5:127920886-127920908 TTTGTCTTTTTGGAGAAATAGGG - Intergenic
997433766 5:133859088-133859110 TTTATGTTTTTGGAGAGACAGGG + Intergenic
998236649 5:140403386-140403408 TTTTGGGTTCTGGGGAAAAAGGG + Intronic
998938116 5:147252138-147252160 TTTTTGTTTTTGGTGAGACAGGG - Intronic
998983297 5:147727806-147727828 ATTGTGTTTTTCTGGAAAAAAGG + Intronic
999025274 5:148222631-148222653 TTTTAATATTTGGGGAAAAATGG + Intergenic
999261666 5:150242280-150242302 TTTCTACTTTTGGTGAAAGAGGG - Intronic
999778926 5:154833523-154833545 TGTGTGTTTTTAGTGAAAAAGGG + Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000689923 5:164304859-164304881 TTGCTCTTTTTTGGGAAGAAAGG + Intergenic
1001243067 5:170084753-170084775 TTTCTGTAGTTGTGGGAAAAGGG - Intergenic
1002410682 5:179073684-179073706 TTTCTGTTTTTTGAGACAGAGGG + Intronic
1002810151 6:620783-620805 TTACTCGTTTGGGGGAAAAATGG + Intronic
1002895941 6:1380243-1380265 TTTCTGTTTTATGGTAAAATGGG - Intergenic
1003508352 6:6758819-6758841 TTTCTTTTTTTTTGGAAAGAAGG - Intergenic
1003585248 6:7382735-7382757 TTTGTGTTTTTGTAGAAACAGGG - Intronic
1004361490 6:14975162-14975184 TTTTTTTTTTTGGTGATAAATGG - Intergenic
1004902728 6:20209043-20209065 TTCCTGTTTTGGGGGAATCAAGG - Intronic
1004965167 6:20841005-20841027 TTTTTGTTTTTGTGGAGACAAGG + Intronic
1005134485 6:22552048-22552070 ATTATCTTTTAGGGGAAAAATGG + Intergenic
1005508028 6:26486995-26487017 TTTATTTTTTTGTGGAAACAGGG + Intergenic
1005688223 6:28275998-28276020 TGACTGTCTTTGGGGAAAGATGG - Intronic
1005877461 6:30022909-30022931 TTTCTGTTTTTTGGTAGAGATGG - Intergenic
1006053784 6:31365284-31365306 TTTGTGTTTTTGGTGAAGACGGG - Intergenic
1006094918 6:31649928-31649950 TTTGTATTTTTGGTAAAAAAGGG - Intronic
1006138597 6:31913019-31913041 TTTTTTTTTTTGTGGAAACAGGG - Intronic
1006230041 6:32578735-32578757 TTTCTGTCTTTGGAGCCAAATGG + Intronic
1007128041 6:39443899-39443921 TTCATGTTTTGGGGAAAAAAAGG + Intronic
1007185481 6:39967717-39967739 TTTCAGTTTTTGGGTGAAAGTGG - Intergenic
1007650592 6:43418204-43418226 TTTCTTTCTTTAGGGAAAGAGGG - Intergenic
1007918625 6:45586234-45586256 TTTCTGTTTTTTGGTAACTATGG + Intronic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008219367 6:48837128-48837150 TTTCTGTTTGTGGGGAATACAGG + Intergenic
1008403561 6:51093230-51093252 TTTGTATTTTTTGGTAAAAACGG - Intergenic
1008906814 6:56686813-56686835 CTTCTGTTTCTGGAGAAAAGAGG - Intronic
1008988643 6:57577045-57577067 ATGCAGTTTTTGGGGAAACATGG - Intronic
1009177245 6:60475604-60475626 ATGCAGTTTTTGGGGAAACATGG - Intergenic
1009180262 6:60508858-60508880 TTTCTCTTTTCGGGGAGGAAAGG - Intergenic
1009701520 6:67188750-67188772 TTTCTTTTTTTTGGGATACAAGG - Intergenic
1010205209 6:73316353-73316375 TTACTATTTTTGGGGAGATAAGG - Intergenic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010244430 6:73650186-73650208 TTTTTTTTTTTGTAGAAAAAAGG - Intronic
1010264913 6:73855286-73855308 TTTCTCTTTTCTGGGAAAACAGG + Intergenic
1010316300 6:74454562-74454584 TTTCTATATTTATGGAAAAAAGG + Intergenic
1010419716 6:75658963-75658985 TTTTTTTTTTTGGGGAGACAAGG - Intronic
1010498285 6:76562988-76563010 TTTATATTTTTGGGCAAACAAGG + Intergenic
1010785799 6:79999634-79999656 TTACTGCTTTTGTGGAAGAAAGG - Intergenic
1011479432 6:87779418-87779440 TTTCTTTTTTTTTGGTAAAACGG + Intergenic
1011826450 6:91311304-91311326 TTTCTTTTTTTGCAGAACAAAGG - Intergenic
1012454295 6:99387654-99387676 TTTCTGATTTTAGGGGGAAAGGG - Intronic
1013564042 6:111338621-111338643 AGTTTGTTTTTGGGCAAAAATGG + Intronic
1013954733 6:115827873-115827895 GTTGTGTTTTGGGGAAAAAAAGG + Intergenic
1014272706 6:119350447-119350469 TTTGTTTTTTGGGGGAAGAAAGG - Intergenic
1014305493 6:119736156-119736178 TTTCTGTATTTGTGTAAAACCGG - Intergenic
1014823572 6:126021608-126021630 GTTCTGCTTTTGGAGAAAAATGG - Intronic
1015131570 6:129817314-129817336 TTTCTGTTTGAGGGAAAATATGG + Intergenic
1015357194 6:132292501-132292523 TTTCTGTTTTTGGTAAAGACAGG - Intergenic
1015461507 6:133496805-133496827 TTTCTCATTTTGGAGAAAGAAGG - Intronic
1015594686 6:134855196-134855218 TTTCTCTCTTGGGGGAAAGAAGG + Intergenic
1015647565 6:135410841-135410863 TTTCCTTTTTTGGGGAAGCAGGG + Intronic
1015656701 6:135526543-135526565 CTTCTGTTTTAGTGGAATAAAGG + Intergenic
1015734523 6:136384498-136384520 TTTTTTTTTTTGGGGAGACAGGG + Intronic
1015767081 6:136730169-136730191 TTTTTGTTTTTGTAGAAACAAGG + Intronic
1015775850 6:136813314-136813336 TTTCTGCATTTGGTGATAAATGG - Intergenic
1015843527 6:137496165-137496187 TTTCTGTAATGGGGGAAAAATGG + Intergenic
1015993026 6:138967894-138967916 TTCCTGTGTTTGGGGAATAAAGG - Intronic
1016257875 6:142130756-142130778 TTTCTTTTTTTAATGAAAAAGGG + Intergenic
1016462689 6:144294587-144294609 TTTCTTTTTTGGGGGGAAATTGG + Intronic
1016760582 6:147731815-147731837 TTTCTGTATTTGTGGAGCAAAGG + Intronic
1017641761 6:156501149-156501171 ATCCTATTTATGGGGAAAAAAGG + Intergenic
1017781760 6:157720891-157720913 TTTTTGTTTTTGTAGAAACAAGG - Intronic
1018161304 6:161045443-161045465 ATTATGTTTATGTGGAAAAATGG + Intronic
1018347347 6:162914590-162914612 TTTTTTTTTTTTGGTAAAAATGG - Intronic
1018601931 6:165553214-165553236 TTTCTTTTTTTGGGGAGGAGGGG + Intronic
1019232329 6:170578274-170578296 TTTGTTTCTTTGGGTAAAAAAGG - Intronic
1019724924 7:2596251-2596273 TTTCTTTTTTTAGTGAGAAAAGG - Intronic
1020031411 7:4935501-4935523 TTTATTTTTTTGTGGAAATAAGG - Intronic
1020098540 7:5381616-5381638 TTTCTTTTTTTTTGGAAACAGGG - Intronic
1020369401 7:7415807-7415829 TTTCTTTTTTTGGGAAGACAAGG + Intronic
1021268681 7:18558026-18558048 TTTCTGTATTTGGGGCCCAAAGG - Intronic
1022065460 7:26851245-26851267 TTTTTTTTTTTTGGTAAAAACGG - Intronic
1022258716 7:28683934-28683956 TTACTATTTTTGGTGCAAAATGG - Intronic
1023044360 7:36198186-36198208 TTTGTGTGTTTTGAGAAAAATGG + Intronic
1023104871 7:36754017-36754039 TTTCTGTTTTTGATGAAAATTGG - Intergenic
1023798252 7:43811548-43811570 TATCTGTTTTTAAGGGAAAAAGG - Intergenic
1023976841 7:45036823-45036845 TTTCTGTGTTTGGTGATAAGGGG + Intronic
1024627815 7:51223349-51223371 GGGCTGCTTTTGGGGAAAAAAGG + Intronic
1024675009 7:51630459-51630481 TTTCTATTTTTGAGTACAAATGG - Intergenic
1024689316 7:51782018-51782040 CTTCTGAATTTGGGGAAAAAAGG + Intergenic
1026026456 7:66748451-66748473 TTTCTGTTGTTGGTGAATCACGG + Intronic
1026060362 7:67020205-67020227 TTTTTGTTTTTGTGGAAACAGGG - Intronic
1026310616 7:69180675-69180697 TTGCTCTTTGTGGGAAAAAATGG + Intergenic
1026325224 7:69303450-69303472 TTTGTATTTTTGGGAAAAATAGG + Intergenic
1026528323 7:71174901-71174923 TTTCTGTCTTTGGGGAGCGATGG + Intronic
1026729959 7:72903107-72903129 TTTTTCTTTTTGGGGGGAAAAGG - Intronic
1027376353 7:77554858-77554880 TTTCTGTTTTTGTAGAAACGAGG + Intronic
1027496677 7:78895814-78895836 TTTATAGTTTTGAGGAAAAAGGG + Intronic
1027658693 7:80962697-80962719 TTTTTTTTTTTTGGGAAAAATGG + Intergenic
1027835848 7:83240859-83240881 TTTCTGTTTTTCGGGATCCATGG + Intergenic
1028441242 7:90864118-90864140 TTTTTTTTTTTAAGGAAAAATGG - Intronic
1028720533 7:94025907-94025929 TTTTTTTTTTTTGGGAAAAGGGG - Intergenic
1028856391 7:95597999-95598021 TTTCTATTTTTGGTGAAGATGGG + Intergenic
1029580356 7:101433149-101433171 TTTCTGTTTTTAGTGGAAACGGG - Intronic
1029673726 7:102051475-102051497 TTTCTGTATTTTGGTAAAGACGG - Intronic
1029821417 7:103150883-103150905 TTTTTTTTTTTGGGGAAATGGGG - Intergenic
1029851834 7:103469622-103469644 TTTCTTTTTTTGGGGGACAGAGG + Intergenic
1029894346 7:103966715-103966737 TATCTGTTTTTGGAAAATAAAGG - Intronic
1030197361 7:106865630-106865652 TTTTTGTTTTGGGAGGAAAAGGG + Exonic
1030448265 7:109674735-109674757 TTACTGGTTTTGGCGAGAAATGG - Intergenic
1030471699 7:109972159-109972181 TTTGAGTATTTGGGGAAAAAAGG + Intergenic
1030898521 7:115092328-115092350 TTTTTGTTTTTAGTAAAAAATGG + Intergenic
1031085820 7:117300625-117300647 TTTCTTTTTTTGTAGAAACAGGG - Intronic
1031206038 7:118758620-118758642 TTTCTGTTTTCAGGTGAAAATGG - Intergenic
1031283583 7:119837698-119837720 TTTGTTTTTGTGGGGAAGAAGGG - Intergenic
1031404442 7:121367792-121367814 TTTCTATTTTTGTGGAAATGGGG - Intronic
1031539911 7:122982366-122982388 TTTCTGTTTTTAGGAAGACAGGG - Intergenic
1031745240 7:125487809-125487831 TTTTTGTTTTTGGAGAGAATAGG - Intergenic
1031898225 7:127379072-127379094 TTTCTGATTTTGTGGTAATAAGG - Intronic
1031974972 7:128087870-128087892 TTTCTGTTTCTGGGGATAGAGGG - Intronic
1032063128 7:128741556-128741578 TTTCTCTTTTTGGACAAAAAGGG - Intronic
1032139399 7:129313252-129313274 TTTTTGTTTTTAGAGAATAAGGG + Intronic
1032443085 7:131957273-131957295 AATCTATTTTTGAGGAAAAAAGG + Intergenic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1032823255 7:135544246-135544268 TTTGTTTTCTTGGGAAAAAAGGG + Intergenic
1033163834 7:139020981-139021003 TTTTTTTTTTTGGGGAGACAGGG - Intergenic
1033421630 7:141209215-141209237 TCAATGGTTTTGGGGAAAAAAGG - Intronic
1035810672 8:2488576-2488598 TGGCTGGTTTTGGGGAAAAGGGG - Intergenic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036109811 8:5885756-5885778 TCACTGTTTTCAGGGAAAAAAGG + Intergenic
1036110103 8:5889566-5889588 TTTCTGCTTTTTGTGAAAAAAGG - Intergenic
1036117419 8:5972995-5973017 TTGGTGTTTTAGGGGAAAAGAGG - Intergenic
1036292790 8:7509191-7509213 TTTCTGTTTTTGCAGCAAAATGG - Exonic
1036329772 8:7811818-7811840 TTTCTGTTTTTGCAGCAAAATGG + Exonic
1037046217 8:14307522-14307544 TTTCTTTTTTTGCTGAAGAAAGG - Intronic
1037285703 8:17296720-17296742 TTTCTGTTTTTCTGGTGAAAAGG - Exonic
1037704792 8:21309973-21309995 TTTTTTTTTTTTGGCAAAAAGGG + Intergenic
1038763238 8:30404449-30404471 TTTCTTTTTTTTTGGAAATAGGG + Intronic
1039345286 8:36696948-36696970 TTTTTTTTTTTGGAGAAATAGGG + Intergenic
1039568678 8:38569029-38569051 TGGCTGGTTTTGGGGAAAAGAGG + Intergenic
1039814487 8:41080959-41080981 TTTTTGTTTTTGAGGAGATAGGG - Intergenic
1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG + Intronic
1039950533 8:42168419-42168441 TTTCTGTTTTTCTGTACAAACGG + Intronic
1039954609 8:42197396-42197418 TGACTGTTCTTGGGGAAAACGGG + Intronic
1040548607 8:48421306-48421328 TGTGTGTTTATGAGGAAAAACGG - Intergenic
1041069003 8:54108164-54108186 TTTTTGTTTTTGTAGAAACAAGG - Intergenic
1041622245 8:59985424-59985446 TTTCTATTTCTGTGAAAAAATGG + Intergenic
1041650706 8:60299403-60299425 TCTCTTTTTTAGGGGAAGAAAGG - Intergenic
1042052326 8:64724860-64724882 TGTCTGTCTTTGGGGAAAAGGGG - Intronic
1042079884 8:65040107-65040129 TTTCTGTCTTTGGGGGAAGTTGG + Intergenic
1042557190 8:70043431-70043453 TTTGTATTTTTGGGGAAATGGGG - Intergenic
1042760917 8:72270600-72270622 TTTCTGTTTTTGGCTATGAATGG + Intergenic
1043172406 8:76981454-76981476 TGTTTGTTTTTGGTGAGAAAGGG - Exonic
1043202129 8:77383439-77383461 TTTTTTTTTTTGGAGAGAAAAGG - Intergenic
1043779744 8:84316797-84316819 TTTCTATTTTAGCAGAAAAATGG + Intronic
1043866960 8:85385781-85385803 TTTTTATTTTTGGTGACAAATGG - Intronic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1044889993 8:96824818-96824840 TTTCAGTGGTTGGGGATAAATGG + Intronic
1045235024 8:100344067-100344089 TTTTTGTTTTAGTGGGAAAAGGG + Intronic
1045875386 8:106975435-106975457 TGTCTGGCTTTGGGGAAAACGGG + Intergenic
1046322940 8:112601726-112601748 TTCCTGGTATTGGGGAAAAAGGG + Intronic
1046460276 8:114525086-114525108 TTTCTGGTTTTGTTGTAAAATGG + Intergenic
1046531787 8:115455701-115455723 ATTCTGTCTTTGGAGGAAAAAGG - Intronic
1046612666 8:116443240-116443262 GTTCTATTTATGGGGGAAAAAGG - Intergenic
1046648843 8:116814645-116814667 TTTGTGTTTTTTGGTAGAAATGG - Intronic
1047371537 8:124260082-124260104 TTTCTATGTTTGGGGAAAAAGGG + Intergenic
1048152997 8:131911980-131912002 TGACTGGGTTTGGGGAAAAAGGG + Intronic
1048217357 8:132508558-132508580 TTTCTCTTTTAAGGGAAAAGAGG + Intergenic
1048356563 8:133658511-133658533 TTTCTGTTTTTGAGGAAATGAGG + Intergenic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1048514126 8:135090302-135090324 TTTTTGTTAAAGGGGAAAAATGG + Intergenic
1049103055 8:140593101-140593123 TGTATGTTTTGGGTGAAAAAAGG - Intronic
1049740011 8:144234686-144234708 TTTTTTTTTTTTGGTAAAAATGG + Intronic
1049926095 9:408922-408944 TTACTCTTTTGGGGGAGAAAGGG - Intronic
1049995873 9:1033057-1033079 TTTTTGTTTTTGTGGACACAGGG - Intergenic
1050176516 9:2874681-2874703 TTTTTTTTTTCAGGGAAAAAAGG + Intergenic
1050187445 9:2989529-2989551 TTTCTGTTGTTGGGCAATACAGG - Intergenic
1050346077 9:4689076-4689098 TTTTTTCTATTGGGGAAAAAGGG + Intronic
1050362982 9:4848192-4848214 TTTTTCTTTTTGGGTAGAAAAGG + Intronic
1051202131 9:14638365-14638387 TTTCTGTATATGGTGAGAAATGG - Intronic
1051339477 9:16098189-16098211 TTTATGCATTAGGGGAAAAAAGG - Intergenic
1051694292 9:19751600-19751622 AATCATTTTTTGGGGAAAAAAGG + Intronic
1051707307 9:19894102-19894124 TTTATGTTTTTGAGGAAGAAGGG + Intergenic
1051722824 9:20056183-20056205 CTTTTGTTTCTTGGGAAAAATGG - Intergenic
1051733309 9:20170533-20170555 GTGCAGTTTTGGGGGAAAAATGG + Intergenic
1051880814 9:21837987-21838009 TCTCTCGTTTTGGGGCAAAACGG - Exonic
1052007511 9:23366864-23366886 TTTCTTTTTTATGGGAAACAGGG + Intergenic
1052116233 9:24651483-24651505 TGTCTGTTTTCTGGGAAAACTGG + Intergenic
1052361503 9:27565699-27565721 TTTCTACTTTAGGGAAAAAATGG + Intronic
1052417358 9:28193584-28193606 ACTATGTTTTAGGGGAAAAAAGG + Intronic
1052758923 9:32569686-32569708 TTTCTTTTTTTTTGGAAACATGG + Intronic
1052906800 9:33842225-33842247 TTTTTATTTTTGTGGAAACAAGG - Intronic
1053045201 9:34909792-34909814 TTTCTGTTTTTTGGTAGAGACGG + Intergenic
1053507656 9:38657470-38657492 ATGTTGTTTTTGGGGAAGAATGG + Intergenic
1053752249 9:41268536-41268558 TTTTTGTATTTGGTGAAATATGG + Intergenic
1054257775 9:62832868-62832890 TTTTTGTATTTGGTGAAATATGG + Intergenic
1054911247 9:70457258-70457280 TTTCTTTTTTTGCTGAGAAAGGG - Intergenic
1054989178 9:71301888-71301910 TTTCTATTTCTGTGGAAACATGG + Intronic
1055041328 9:71876592-71876614 TTTTTCTTTTTGGAGAAAATTGG - Intronic
1055191016 9:73524151-73524173 TTTGTGTTTTTGGTAGAAAAGGG - Intergenic
1055323801 9:75107505-75107527 TATCTGCTTTTGGGGGAAATGGG + Intronic
1055552353 9:77443586-77443608 TTTTTGTTGTTGGAGAAAAGAGG - Intronic
1055644303 9:78348303-78348325 CTTCTGTTTTTAGGAAGAAATGG + Intergenic
1055890180 9:81115891-81115913 TTTCTCTTTTTGGGGGGAGAGGG - Intergenic
1057158244 9:92864147-92864169 GTTCTGTTATTAGGGAAGAAAGG - Intronic
1057789171 9:98111400-98111422 TTGTTGTTTTTTGGTAAAAATGG - Intronic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1058424461 9:104864381-104864403 TTTCTGTTCTTGGGAGAAACAGG + Intronic
1058611588 9:106782329-106782351 TTTGTAGTTTTGGAGAAAAAAGG - Intergenic
1058800885 9:108543466-108543488 ATTCTGTGTTTGGGGAAATGGGG - Intergenic
1058841871 9:108917596-108917618 ATTGTGTTTTTTGAGAAAAATGG - Exonic
1058887670 9:109334142-109334164 TTTTTGTTTTTGGGAAAAAAAGG - Intergenic
1058981186 9:110172316-110172338 TTTCTTTTTTTGGGGGAGGAGGG + Exonic
1059024966 9:110616592-110616614 ATTCTGGTTATGGGGAAAAAAGG - Intergenic
1059103523 9:111491910-111491932 TTCCTGCTTTGGGGAAAAAAAGG + Intergenic
1059637636 9:116186477-116186499 TTTCTTTCTTTGGGGATAAATGG + Intronic
1059775008 9:117465596-117465618 TTTCTCTTTTTGGTGAAGCAGGG + Intergenic
1062325965 9:136012617-136012639 ATTCTGTTTTAGAGCAAAAAGGG - Intronic
1062659936 9:137624768-137624790 TTTCTGTTTTTGTAGAGACAGGG + Intronic
1202800988 9_KI270719v1_random:175475-175497 TTTTTGTATTTGGTGAAATATGG - Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1185503556 X:616631-616653 TGGCTGGTTTTGGGGAAAAGGGG - Intergenic
1185540416 X:898939-898961 TTTCTATTTTGGGGGGAAATGGG - Intergenic
1185876139 X:3703841-3703863 TTTGTATTTTTGGGTACAAACGG + Intronic
1186154518 X:6711518-6711540 TGTCTGGCTTTGGGGCAAAAGGG + Intergenic
1186395037 X:9199363-9199385 ATTCTGCTTTTGGGGATAATCGG + Intergenic
1187180260 X:16937228-16937250 TTTCTGCTATTAGTGAAAAAAGG - Intergenic
1187233748 X:17446646-17446668 TTTTTTTTTTTTGGGCAAAAAGG - Intronic
1187288320 X:17927676-17927698 TTTTTTTTTTTGTGGAAACAGGG - Intergenic
1187331721 X:18346380-18346402 TTTCTTTTTTTGGTGAATATTGG - Intronic
1187509627 X:19906024-19906046 TTTCTGTATATGGAAAAAAACGG + Intergenic
1188002653 X:24996589-24996611 TTTCTATTTAAGGGGCAAAAAGG - Exonic
1188081424 X:25846155-25846177 TTTCTTTTTTTGGTGGAGAATGG + Intergenic
1188097403 X:26041980-26042002 ATTCTCTCTCTGGGGAAAAATGG + Intergenic
1188186533 X:27123263-27123285 TTAATTTTTTTGGGGGAAAAAGG + Intergenic
1188377949 X:29456102-29456124 TTTCTATTTTTGGGTAGACATGG - Intronic
1188776338 X:34224185-34224207 TTTCTGTGTTTGGGGAATAGGGG - Intergenic
1188839560 X:34999374-34999396 TTTATATTTTTGGGGGAAGATGG + Intergenic
1189015820 X:37095688-37095710 TTTCTTTTTTTTTGGAAATAGGG + Intergenic
1189065117 X:37799566-37799588 TTTCTGTTTATGAGGCATAAAGG + Intronic
1189226142 X:39414852-39414874 TTTTATTTCTTGGGGAAAAAAGG + Intergenic
1189556368 X:42149552-42149574 TTTCTGTAGTAGGAGAAAAAAGG - Intergenic
1190107455 X:47570417-47570439 GTTCTGTTTCTGGGGAAAAATGG - Intronic
1190964214 X:55282274-55282296 TTTATGTTTCTGTGGAAGAATGG + Intronic
1191626823 X:63278949-63278971 TTTCTGATTTTGGGGGTATAAGG - Intergenic
1191953282 X:66617543-66617565 TTTCTGTTTTGTGGGCAAAAAGG - Intronic
1192545651 X:72010654-72010676 TTTCTGTTTTAGGAGACATATGG + Intergenic
1192850177 X:74947063-74947085 TTTTAGTTTTTGGGTGAAAAGGG + Intergenic
1192972102 X:76243652-76243674 TTTGTATTTTTTGGGAGAAATGG - Intergenic
1193912703 X:87325482-87325504 GACCTGTTTTGGGGGAAAAAGGG + Intergenic
1194271063 X:91816351-91816373 TTTCATTTTTTAGGGAAGAAAGG + Intronic
1194489147 X:94525590-94525612 TTTCTATTTCTGTGAAAAAATGG - Intergenic
1194858157 X:98959969-98959991 TTTCTGTTTCTTCTGAAAAATGG - Intergenic
1194880859 X:99250292-99250314 TTTCAGCTTTTATGGAAAAACGG + Intergenic
1195244727 X:102985148-102985170 TTTCTGTTTTTGGAGAGATGGGG + Intergenic
1195281767 X:103342610-103342632 TTTCTGTTTTTGGAGAGACCGGG - Intergenic
1195743071 X:108085981-108086003 TTTCTATTTATGGAGAAAAGAGG + Intronic
1196148727 X:112348434-112348456 TTTTTTATTTTGTGGAAAAAAGG - Intergenic
1196222807 X:113131498-113131520 TGTCTGTTTTTGGTAAATAAAGG + Intergenic
1197125870 X:122945480-122945502 TCTATGCTTTTGGGGAAAATGGG - Intergenic
1197145701 X:123169915-123169937 TTTCTCTTTTTGGGTAGGAATGG - Intergenic
1197186898 X:123597650-123597672 TTTCTGTTTTTTTTGAAACAGGG - Intergenic
1197469761 X:126852990-126853012 TTTCTATTTTTTGGGAGACAGGG + Intergenic
1197512267 X:127384988-127385010 TATCTGCTTTTGTGGAACAATGG - Intergenic
1197698649 X:129578693-129578715 TTTCTGTTCATGGGCAAACATGG - Intronic
1198058580 X:133020721-133020743 ATGCTGGCTTTGGGGAAAAAGGG + Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1199378008 X:147134940-147134962 TTTTTTTTTTTGAGGTAAAAAGG + Intergenic
1199730320 X:150625646-150625668 TTACTGCTTTTAGGGAAACATGG + Intronic
1200434218 Y:3128860-3128882 TTTCTGTTTGTAGGGGAAACTGG + Intergenic
1200588304 Y:5037793-5037815 TTTCATTTTTTAGGGAAGAAAGG + Intronic
1200789444 Y:7286582-7286604 TTTGTATTTTTGGGTACAAACGG - Intergenic
1200933958 Y:8722114-8722136 GGTCTGGTTTTGGGAAAAAAAGG + Intergenic
1201014408 Y:9585323-9585345 TTTTTGTTTTTGTAGAAAAGAGG - Intergenic
1202028644 Y:20551194-20551216 TTTGTATTTTTGGGGAGACAGGG + Intergenic