ID: 1036025326

View in Genome Browser
Species Human (GRCh38)
Location 8:4901131-4901153
Sequence GCATGTTCAAAGTGTCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036025323_1036025326 2 Left 1036025323 8:4901106-4901128 CCCTCGTCAGTATTACACAGCAA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1036025326 8:4901131-4901153 GCATGTTCAAAGTGTCATCTGGG No data
1036025324_1036025326 1 Left 1036025324 8:4901107-4901129 CCTCGTCAGTATTACACAGCAAT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1036025326 8:4901131-4901153 GCATGTTCAAAGTGTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036025326 Original CRISPR GCATGTTCAAAGTGTCATCT GGG Intronic
No off target data available for this crispr