ID: 1036029596

View in Genome Browser
Species Human (GRCh38)
Location 8:4953878-4953900
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036029589_1036029596 12 Left 1036029589 8:4953843-4953865 CCTGTTCAAATGCAGGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1036029596 8:4953878-4953900 GCTTAGAGATTGGACTACCCAGG No data
1036029588_1036029596 13 Left 1036029588 8:4953842-4953864 CCCTGTTCAAATGCAGGTTGCAG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1036029596 8:4953878-4953900 GCTTAGAGATTGGACTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr