ID: 1036036733

View in Genome Browser
Species Human (GRCh38)
Location 8:5028263-5028285
Sequence GCCCTGAATCCTGTCTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036036733_1036036739 19 Left 1036036733 8:5028263-5028285 CCCTTTGAGACAGGATTCAGGGC No data
Right 1036036739 8:5028305-5028327 GTCAGCCTCGAATGTCACTGGGG No data
1036036733_1036036738 18 Left 1036036733 8:5028263-5028285 CCCTTTGAGACAGGATTCAGGGC No data
Right 1036036738 8:5028304-5028326 AGTCAGCCTCGAATGTCACTGGG No data
1036036733_1036036737 17 Left 1036036733 8:5028263-5028285 CCCTTTGAGACAGGATTCAGGGC No data
Right 1036036737 8:5028303-5028325 GAGTCAGCCTCGAATGTCACTGG No data
1036036733_1036036736 -8 Left 1036036733 8:5028263-5028285 CCCTTTGAGACAGGATTCAGGGC No data
Right 1036036736 8:5028278-5028300 TTCAGGGCAGGCTGCTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036036733 Original CRISPR GCCCTGAATCCTGTCTCAAA GGG (reversed) Intergenic