ID: 1036040073

View in Genome Browser
Species Human (GRCh38)
Location 8:5067932-5067954
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036040073_1036040075 21 Left 1036040073 8:5067932-5067954 CCATAGTACGAAGCACTTAAAAG No data
Right 1036040075 8:5067976-5067998 AATCATGAATATCTCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036040073 Original CRISPR CTTTTAAGTGCTTCGTACTA TGG (reversed) Intergenic
No off target data available for this crispr