ID: 1036042211

View in Genome Browser
Species Human (GRCh38)
Location 8:5097964-5097986
Sequence CATATGTTAGCTCTGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036042205_1036042211 20 Left 1036042205 8:5097921-5097943 CCCTTTCTCTTGGGGTATATACC No data
Right 1036042211 8:5097964-5097986 CATATGTTAGCTCTGTTTTTAGG No data
1036042209_1036042211 -2 Left 1036042209 8:5097943-5097965 CCATCCGTGAAGTTGCTGGATCA No data
Right 1036042211 8:5097964-5097986 CATATGTTAGCTCTGTTTTTAGG No data
1036042208_1036042211 -1 Left 1036042208 8:5097942-5097964 CCCATCCGTGAAGTTGCTGGATC No data
Right 1036042211 8:5097964-5097986 CATATGTTAGCTCTGTTTTTAGG No data
1036042206_1036042211 19 Left 1036042206 8:5097922-5097944 CCTTTCTCTTGGGGTATATACCC No data
Right 1036042211 8:5097964-5097986 CATATGTTAGCTCTGTTTTTAGG No data
1036042210_1036042211 -6 Left 1036042210 8:5097947-5097969 CCGTGAAGTTGCTGGATCATATG No data
Right 1036042211 8:5097964-5097986 CATATGTTAGCTCTGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036042211 Original CRISPR CATATGTTAGCTCTGTTTTT AGG Intergenic
No off target data available for this crispr