ID: 1036044707

View in Genome Browser
Species Human (GRCh38)
Location 8:5126877-5126899
Sequence AGTCCTTTACAGATGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036044701_1036044707 24 Left 1036044701 8:5126830-5126852 CCTGTGGTAGGGCACTCCACAGT No data
Right 1036044707 8:5126877-5126899 AGTCCTTTACAGATGGAGTCAGG No data
1036044703_1036044707 8 Left 1036044703 8:5126846-5126868 CCACAGTCTATGCAGGAAATGTA No data
Right 1036044707 8:5126877-5126899 AGTCCTTTACAGATGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036044707 Original CRISPR AGTCCTTTACAGATGGAGTC AGG Intergenic
No off target data available for this crispr