ID: 1036047516

View in Genome Browser
Species Human (GRCh38)
Location 8:5160384-5160406
Sequence CTGTGGGAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036047516_1036047522 -8 Left 1036047516 8:5160384-5160406 CCATCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1036047522 8:5160399-5160421 TCCCACAGTGCTGGGATTATAGG 0: 278
1: 31198
2: 327055
3: 249294
4: 135373
1036047516_1036047525 11 Left 1036047516 8:5160384-5160406 CCATCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1036047525 8:5160418-5160440 TAGGTTTGAGCCACAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036047516 Original CRISPR CTGTGGGAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr