ID: 1036049052

View in Genome Browser
Species Human (GRCh38)
Location 8:5175285-5175307
Sequence AAATATTATTAGCGTGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036049050_1036049052 18 Left 1036049050 8:5175244-5175266 CCTATGTGTACACTTAACAGAGA No data
Right 1036049052 8:5175285-5175307 AAATATTATTAGCGTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036049052 Original CRISPR AAATATTATTAGCGTGCACC AGG Intergenic
No off target data available for this crispr