ID: 1036057644

View in Genome Browser
Species Human (GRCh38)
Location 8:5275903-5275925
Sequence CAAAGGAAACAGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036057644_1036057647 16 Left 1036057644 8:5275903-5275925 CCTTCCTTCTTCTGTTTCCTTTG No data
Right 1036057647 8:5275942-5275964 CATTTTTATGTTACTGACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036057644 Original CRISPR CAAAGGAAACAGAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr