ID: 1036057647

View in Genome Browser
Species Human (GRCh38)
Location 8:5275942-5275964
Sequence CATTTTTATGTTACTGACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036057644_1036057647 16 Left 1036057644 8:5275903-5275925 CCTTCCTTCTTCTGTTTCCTTTG No data
Right 1036057647 8:5275942-5275964 CATTTTTATGTTACTGACGTAGG No data
1036057645_1036057647 12 Left 1036057645 8:5275907-5275929 CCTTCTTCTGTTTCCTTTGAGTT No data
Right 1036057647 8:5275942-5275964 CATTTTTATGTTACTGACGTAGG No data
1036057646_1036057647 -1 Left 1036057646 8:5275920-5275942 CCTTTGAGTTTATTTTGCTCTTC No data
Right 1036057647 8:5275942-5275964 CATTTTTATGTTACTGACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036057647 Original CRISPR CATTTTTATGTTACTGACGT AGG Intergenic
No off target data available for this crispr