ID: 1036060588

View in Genome Browser
Species Human (GRCh38)
Location 8:5314594-5314616
Sequence ATGAAGCAACAGATGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036060585_1036060588 20 Left 1036060585 8:5314551-5314573 CCCTGTGATTTTGTTAGGAGATA No data
Right 1036060588 8:5314594-5314616 ATGAAGCAACAGATGAAACTGGG No data
1036060586_1036060588 19 Left 1036060586 8:5314552-5314574 CCTGTGATTTTGTTAGGAGATAT No data
Right 1036060588 8:5314594-5314616 ATGAAGCAACAGATGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036060588 Original CRISPR ATGAAGCAACAGATGAAACT GGG Intergenic
No off target data available for this crispr