ID: 1036061332

View in Genome Browser
Species Human (GRCh38)
Location 8:5324710-5324732
Sequence CAGTGTATGAAAAATGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036061332_1036061333 3 Left 1036061332 8:5324710-5324732 CCTGTAACATTTTTCATACACTG No data
Right 1036061333 8:5324736-5324758 ATGATAGACACCCAGTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036061332 Original CRISPR CAGTGTATGAAAAATGTTAC AGG (reversed) Intergenic
No off target data available for this crispr