ID: 1036063554

View in Genome Browser
Species Human (GRCh38)
Location 8:5353501-5353523
Sequence GCTTGAATCTGGGGGGTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036063554_1036063566 23 Left 1036063554 8:5353501-5353523 CCTCCGACCCCCCAGATTCAAGC No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063554_1036063567 24 Left 1036063554 8:5353501-5353523 CCTCCGACCCCCCAGATTCAAGC No data
Right 1036063567 8:5353548-5353570 GTAGCTGAGATTACAGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036063554 Original CRISPR GCTTGAATCTGGGGGGTCGG AGG (reversed) Intergenic