ID: 1036063566

View in Genome Browser
Species Human (GRCh38)
Location 8:5353547-5353569
Sequence AGTAGCTGAGATTACAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036063557_1036063566 15 Left 1036063557 8:5353509-5353531 CCCCCAGATTCAAGCGATTCTCC No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063560_1036063566 12 Left 1036063560 8:5353512-5353534 CCAGATTCAAGCGATTCTCCTGC No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063559_1036063566 13 Left 1036063559 8:5353511-5353533 CCCAGATTCAAGCGATTCTCCTG No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063561_1036063566 -6 Left 1036063561 8:5353530-5353552 CCTGCCTCAGCCTCCCGAGTAGC No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063555_1036063566 20 Left 1036063555 8:5353504-5353526 CCGACCCCCCAGATTCAAGCGAT No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063558_1036063566 14 Left 1036063558 8:5353510-5353532 CCCCAGATTCAAGCGATTCTCCT No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063554_1036063566 23 Left 1036063554 8:5353501-5353523 CCTCCGACCCCCCAGATTCAAGC No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063562_1036063566 -10 Left 1036063562 8:5353534-5353556 CCTCAGCCTCCCGAGTAGCTGAG No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data
1036063556_1036063566 16 Left 1036063556 8:5353508-5353530 CCCCCCAGATTCAAGCGATTCTC No data
Right 1036063566 8:5353547-5353569 AGTAGCTGAGATTACAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036063566 Original CRISPR AGTAGCTGAGATTACAGACA CGG Intergenic