ID: 1036064228

View in Genome Browser
Species Human (GRCh38)
Location 8:5359916-5359938
Sequence TGTTTTATGGGACAATAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036064224_1036064228 17 Left 1036064224 8:5359876-5359898 CCAAGGACAGTATATATTGCCAA No data
Right 1036064228 8:5359916-5359938 TGTTTTATGGGACAATAATCTGG No data
1036064225_1036064228 -2 Left 1036064225 8:5359895-5359917 CCAATAACAGTCTTGTTGAACTG No data
Right 1036064228 8:5359916-5359938 TGTTTTATGGGACAATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036064228 Original CRISPR TGTTTTATGGGACAATAATC TGG Intergenic
No off target data available for this crispr