ID: 1036074066

View in Genome Browser
Species Human (GRCh38)
Location 8:5475101-5475123
Sequence CTTAAACATGTCTACTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036074063_1036074066 8 Left 1036074063 8:5475070-5475092 CCTAGGAACTTCAGTCTCATATT No data
Right 1036074066 8:5475101-5475123 CTTAAACATGTCTACTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036074066 Original CRISPR CTTAAACATGTCTACTTGGA GGG Intergenic
No off target data available for this crispr