ID: 1036076621

View in Genome Browser
Species Human (GRCh38)
Location 8:5509116-5509138
Sequence TGGGTTTTCCCTCAGCCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036076611_1036076621 20 Left 1036076611 8:5509073-5509095 CCTTTGGATGGCGCTGGTCCTAG 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1036076621 8:5509116-5509138 TGGGTTTTCCCTCAGCCGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 119
1036076615_1036076621 2 Left 1036076615 8:5509091-5509113 CCTAGCGGATGCAGGGACCAGCC 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1036076621 8:5509116-5509138 TGGGTTTTCCCTCAGCCGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036076621 Original CRISPR TGGGTTTTCCCTCAGCCGTT GGG Intergenic
900546248 1:3230863-3230885 GGGGTTTTGCCTTGGCCGTTTGG + Intronic
901459040 1:9380641-9380663 TGGGTTTGCTCTTGGCCGTTCGG - Intergenic
904417044 1:30369347-30369369 TGGGTATTTCCTCTGTCGTTGGG + Intergenic
911808080 1:102236136-102236158 TGGGTTATCCCTCAGCATGTTGG - Intergenic
912463586 1:109853778-109853800 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
912864184 1:113242487-113242509 TGGCTCTGCCCTCAGCCATTGGG - Intergenic
921855191 1:219974429-219974451 TGGTTTTTCCCTAAGCCTTAAGG - Intronic
922640125 1:227221883-227221905 CTAGTTTTCCCTCAGCCTTTTGG + Intronic
922684348 1:227627583-227627605 TAGGTGTTCCCTCAGAAGTTAGG + Intronic
922758497 1:228109667-228109689 TGGGTCCTCCCTCAGCCCTCCGG - Intergenic
923759813 1:236831622-236831644 TGGTTTTTGCCTCAGCCTCTTGG + Intronic
1065507169 10:26440139-26440161 TGGGTTTTTTCTCAGCACTTGGG + Intronic
1065620574 10:27576857-27576879 TGGGTTTTCCCACATCCTTTTGG - Intergenic
1066799613 10:39170488-39170510 TGTGTTTTCCTTCAGCAGTTTGG + Intergenic
1066804112 10:39226332-39226354 ATGGTTTTCACTCAGCTGTTTGG + Intergenic
1066931208 10:41761532-41761554 TTCCTTTTCCCTCAGCAGTTTGG + Intergenic
1068337131 10:55648708-55648730 TGTGTTTTCCCAGAGGCGTTAGG - Intergenic
1069662593 10:70133238-70133260 TGGGGTTCCCCTCACACGTTGGG + Intergenic
1070345976 10:75542290-75542312 TGGTTTTTCCCTAAACCCTTGGG + Intronic
1077972648 11:7211229-7211251 TTGGTTTGCCCTCTGCCCTTTGG + Intergenic
1082295216 11:50433136-50433158 TGTCTTTTCACTCAGCAGTTTGG + Intergenic
1082583091 11:54898040-54898062 TTGCTTTTCCTTCAGCAGTTTGG + Intergenic
1083328738 11:61886945-61886967 TGGATTTTCCCACAGTTGTTAGG + Intronic
1083808486 11:65088794-65088816 TGGGGTTTCCATCAGCCCCTCGG + Intronic
1084208324 11:67608777-67608799 TGGGGTTTCCCTGGGCCTTTGGG + Intronic
1085220054 11:74865850-74865872 TGGGTCTTCCCAGAGCCATTTGG + Intronic
1089060713 11:115623805-115623827 TGTTTTTTCCCTAAGCAGTTGGG + Intergenic
1094224404 12:28028900-28028922 CTGGTTTTCCCACAGGCGTTAGG + Intergenic
1095083104 12:38030127-38030149 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
1095139082 12:38640398-38640420 TAGGTGTTCCCTCAGATGTTAGG - Intergenic
1105549292 13:21377757-21377779 TGGGCTTGTCCTCAGCAGTTAGG - Intronic
1105642565 13:22280732-22280754 TGCGTTGTCCCTCACCCGTATGG - Intergenic
1108877010 13:55059921-55059943 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1112227125 13:97550898-97550920 TGCATTTTCTCTCAGCTGTTGGG - Intergenic
1113551067 13:111193502-111193524 TGGGGGTTCCCTCAGAGGTTAGG + Intronic
1115192740 14:30763338-30763360 TGGGTTCTACCTCAGCCTCTTGG + Intergenic
1123846536 15:24309018-24309040 TGGGTTTTCCAGCAGCCTTGAGG - Intergenic
1125398500 15:39275220-39275242 TGGGATTTCCCTCTGCTGTGGGG + Intergenic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1132378620 15:101349556-101349578 TGTGTTTTACCACAGCCTTTAGG - Intronic
1135224845 16:20646811-20646833 TAGGTGTTCCCTCAGAAGTTAGG - Intronic
1139666385 16:68459767-68459789 TGGATTTGCCCTCTGCCCTTGGG + Intergenic
1140859227 16:79004824-79004846 TGGGTTTTCCCTCAGCTTGCTGG + Intronic
1148485486 17:47988073-47988095 TGGGTCTGCCCTCAGGCATTTGG - Intergenic
1150853588 17:68729332-68729354 TGAGTTTTCCCTAGGACGTTGGG - Intergenic
1151977227 17:77489723-77489745 TGGGTTTTCCCACAGACTCTGGG - Intronic
1152428809 17:80236082-80236104 AGGGTTTTACCTCAGCAGTGGGG - Intronic
1152716593 17:81903350-81903372 TAGGTTCTCCCTCCGCCGTTGGG + Intronic
1154251528 18:12749130-12749152 TAGTTTGTCCCTCAGCCTTTGGG + Intergenic
1154360513 18:13656689-13656711 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1160829100 19:1094694-1094716 AGGGTATTGCCTCAGCCATTGGG - Intronic
1163098745 19:15080585-15080607 TGGGTTTTTCCCCAACCTTTGGG + Intergenic
1164173889 19:22750930-22750952 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1166165853 19:40987827-40987849 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
1167871667 19:52375745-52375767 TTGGTTTTCCCTCAGGCTTTGGG + Intronic
924973800 2:155102-155124 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
930920833 2:56751705-56751727 TGTGTTTTCCCACAGACGGTGGG - Intergenic
931805104 2:65796731-65796753 TGGGTTTCCCCTCTGAGGTTCGG + Intergenic
933174917 2:79164299-79164321 TAGGTTTTCCCTCAGAAGTTAGG + Intergenic
936061566 2:109298445-109298467 TGGTTTTTCCCTGAGCCGTGAGG - Intronic
936981759 2:118271304-118271326 TGGGTTTGCCCTAAGCCCATTGG + Intergenic
938768572 2:134480615-134480637 TGGTTTTTCCCTCTGACCTTGGG + Intronic
939493324 2:142901589-142901611 TAGGTGTTCCCTCAGAAGTTAGG + Intronic
940674112 2:156707944-156707966 TGGGTTTTCCCTAAGTGTTTTGG - Intergenic
943568803 2:189547684-189547706 TTGGTTTCCCCTCAGCTGGTGGG + Intergenic
945946533 2:216000750-216000772 TGGGATTTCCTTCAGCAGATTGG - Intronic
1169471157 20:5886721-5886743 TTGGTTTTCCCCCAGACATTGGG - Intergenic
1171799077 20:29593561-29593583 TGTGTTTTCCTTCAGCAGGTTGG + Intergenic
1171844972 20:30262907-30262929 TGTGTTTTCCTTCAGCAGGTTGG - Intergenic
1172326708 20:34041485-34041507 AGGGTTTTCTCTCTGGCGTTGGG + Intronic
1174303794 20:49600880-49600902 TGGGTGATCCCTCGGCCTTTGGG + Intergenic
1174794420 20:53510420-53510442 TGTGTTTTCCCAAAGCCGTTCGG - Intergenic
1176020490 20:62960275-62960297 GGGTGTTTCCCTCAGCCGTGCGG + Intronic
1178599574 21:33984274-33984296 TGGGCCTTCCCTCAGCTGATGGG - Intergenic
1179258797 21:39740388-39740410 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
952921881 3:38290982-38291004 TAGGTGTTCCCTCAGAAGTTAGG + Intronic
952955186 3:38552518-38552540 TGGGATTTGACTCAGACGTTCGG + Intronic
953711400 3:45274037-45274059 TGTGGTTTCCCTCTGCCCTTGGG - Intergenic
954096317 3:48331514-48331536 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
954466854 3:50660359-50660381 TGGGTTATGCCTCAGGCCTTGGG + Intergenic
956513046 3:70015326-70015348 TGGGACTTCCCTCAGCATTTTGG + Intergenic
956999941 3:74873960-74873982 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
958182366 3:90076582-90076604 ATGGTTTTCCCTCAGACCTTTGG - Intergenic
959546840 3:107606396-107606418 GGGCTATTCCTTCAGCCGTTTGG + Intronic
961335168 3:126171731-126171753 TGGGTTTTTCCTCATCACTTAGG - Intronic
965825280 3:172723394-172723416 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
967623890 3:191664439-191664461 TAGGTATTCCCTCAGAAGTTAGG - Intergenic
968391053 4:193351-193373 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
971980185 4:33741738-33741760 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
972179163 4:36442819-36442841 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
972781013 4:42286939-42286961 TCGGTGTTCCCTCAGAAGTTAGG + Intergenic
974838458 4:67277024-67277046 TGGGGTTTCCCCCAGAGGTTAGG + Intergenic
975323308 4:73032935-73032957 TGGGTTGTACCTCAGGAGTTAGG - Intergenic
977411044 4:96664342-96664364 AGAGTTTTCCCTGAGCCTTTGGG + Intergenic
980872462 4:138625624-138625646 TAGGTGTTCCCTCAGAAGTTAGG + Intergenic
986023056 5:3822716-3822738 TGGGTTTTCTCTGAGTCGTTCGG + Intergenic
989108376 5:37884993-37885015 TCCATTTTCCCTCAGCAGTTTGG + Intergenic
995465980 5:112449899-112449921 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1002277496 5:178113529-178113551 CGGGTTTTCCCTCCGCCTTTGGG + Exonic
1002893928 6:1363727-1363749 TGGGCTTTCCCACAGCCTTGGGG + Intergenic
1004236934 6:13882572-13882594 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1005605998 6:27478037-27478059 TGGAGTTTCCCTGAGCCCTTTGG - Intergenic
1006301400 6:33195222-33195244 TGGGTTTTTCCTCGGCCAGTTGG + Intronic
1009063044 6:58419762-58419784 TTGCTTTTCCATCAGCAGTTTGG - Intergenic
1009261239 6:61491844-61491866 TTTGTTTTCCTTCAGCAGTTTGG - Intergenic
1009506371 6:64485298-64485320 TGGGTTTTCTCTAAGCCATTAGG + Intronic
1011077124 6:83449254-83449276 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1013022028 6:106230092-106230114 TGGTTTTTTCCTCAGTCATTTGG - Intronic
1014257065 6:119171439-119171461 TGGGTTTTCCCTAAGACAGTTGG + Intergenic
1014797844 6:125747561-125747583 CAGGTTTTGCCTCAGGCGTTTGG + Intergenic
1020508209 7:9019751-9019773 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1024631976 7:51256511-51256533 TGGGCTTTCACTCAGGAGTTCGG + Intronic
1025530131 7:61869501-61869523 TTCATTTTCCCTCAGCAGTTTGG - Intergenic
1025584015 7:62758660-62758682 TGTCTTTTCACTCAGCAGTTTGG + Intergenic
1026534884 7:71231325-71231347 TGGGTTTTCCCCCAGATATTTGG + Intronic
1030843158 7:114380218-114380240 TAGGTGTTCCCTCAGAAGTTAGG + Intronic
1031471650 7:122174856-122174878 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1033478395 7:141713408-141713430 TGGCTTTTCCCTTCGCCCTTTGG + Intronic
1036076621 8:5509116-5509138 TGGGTTTTCCCTCAGCCGTTGGG + Intergenic
1036140350 8:6201735-6201757 TGCCTTTTGCCTCAGCCGGTGGG - Intergenic
1037875846 8:22547911-22547933 TGAGTTCTCCCGCAGCCTTTGGG + Intronic
1041228947 8:55730051-55730073 TGGGTTTTCTCTGACCCCTTTGG - Intronic
1051904548 9:22080204-22080226 TGGGTTTTCCCCAAGCTGTTTGG + Intergenic
1054364090 9:64213901-64213923 TTTGTTTTCCTTCAGCAGTTTGG - Intergenic
1186075579 X:5874833-5874855 TGGGTTTCTTCTCAGCCTTTAGG + Intronic
1186212284 X:7262071-7262093 GTGGTGCTCCCTCAGCCGTTGGG - Intronic
1188097908 X:26045401-26045423 TGGGGTTTCCCCCAGGGGTTGGG - Intergenic
1189946653 X:46187286-46187308 TAGGTGTTCCCTCAGAAGTTAGG - Intergenic
1192440627 X:71170963-71170985 TGGGTTTTGCCTCTGCCCTTGGG + Intronic
1199550910 X:149060467-149060489 TGGGGTTTACCCCAGCCCTTAGG - Intergenic
1201271820 Y:12263221-12263243 TGGGTCTTCCCCCAGAGGTTAGG + Intergenic
1201729236 Y:17187351-17187373 TGGGGGTTCCCTCAGAGGTTAGG + Intergenic