ID: 1036081672

View in Genome Browser
Species Human (GRCh38)
Location 8:5563354-5563376
Sequence TGGTAGGCCTAGAAATTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036081667_1036081672 22 Left 1036081667 8:5563309-5563331 CCAGCAGTGTATATGATACAGGG No data
Right 1036081672 8:5563354-5563376 TGGTAGGCCTAGAAATTTGTAGG No data
1036081671_1036081672 -9 Left 1036081671 8:5563340-5563362 CCTCTGAGATATATTGGTAGGCC No data
Right 1036081672 8:5563354-5563376 TGGTAGGCCTAGAAATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036081672 Original CRISPR TGGTAGGCCTAGAAATTTGT AGG Intergenic
No off target data available for this crispr