ID: 1036081948

View in Genome Browser
Species Human (GRCh38)
Location 8:5566966-5566988
Sequence CCCTGGCATTACAGGAGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036081948_1036081956 -5 Left 1036081948 8:5566966-5566988 CCCCTACTCCTGTAATGCCAGGG No data
Right 1036081956 8:5566984-5567006 CAGGGCATAGGAAGGCCAGAAGG No data
1036081948_1036081960 22 Left 1036081948 8:5566966-5566988 CCCCTACTCCTGTAATGCCAGGG No data
Right 1036081960 8:5567011-5567033 AGCACAGACATTTAAGGAATGGG No data
1036081948_1036081958 16 Left 1036081948 8:5566966-5566988 CCCCTACTCCTGTAATGCCAGGG No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data
1036081948_1036081959 21 Left 1036081948 8:5566966-5566988 CCCCTACTCCTGTAATGCCAGGG No data
Right 1036081959 8:5567010-5567032 AAGCACAGACATTTAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036081948 Original CRISPR CCCTGGCATTACAGGAGTAG GGG (reversed) Intergenic
No off target data available for this crispr