ID: 1036081958

View in Genome Browser
Species Human (GRCh38)
Location 8:5567005-5567027
Sequence GGAGCAAGCACAGACATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036081945_1036081958 26 Left 1036081945 8:5566956-5566978 CCCAGAGGCACCCCTACTCCTGT No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data
1036081946_1036081958 25 Left 1036081946 8:5566957-5566979 CCAGAGGCACCCCTACTCCTGTA No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data
1036081948_1036081958 16 Left 1036081948 8:5566966-5566988 CCCCTACTCCTGTAATGCCAGGG No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data
1036081955_1036081958 -1 Left 1036081955 8:5566983-5567005 CCAGGGCATAGGAAGGCCAGAAG No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data
1036081951_1036081958 14 Left 1036081951 8:5566968-5566990 CCTACTCCTGTAATGCCAGGGCA No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data
1036081953_1036081958 8 Left 1036081953 8:5566974-5566996 CCTGTAATGCCAGGGCATAGGAA No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data
1036081950_1036081958 15 Left 1036081950 8:5566967-5566989 CCCTACTCCTGTAATGCCAGGGC No data
Right 1036081958 8:5567005-5567027 GGAGCAAGCACAGACATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036081958 Original CRISPR GGAGCAAGCACAGACATTTA AGG Intergenic
No off target data available for this crispr