ID: 1036081959

View in Genome Browser
Species Human (GRCh38)
Location 8:5567010-5567032
Sequence AAGCACAGACATTTAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036081946_1036081959 30 Left 1036081946 8:5566957-5566979 CCAGAGGCACCCCTACTCCTGTA No data
Right 1036081959 8:5567010-5567032 AAGCACAGACATTTAAGGAATGG No data
1036081948_1036081959 21 Left 1036081948 8:5566966-5566988 CCCCTACTCCTGTAATGCCAGGG No data
Right 1036081959 8:5567010-5567032 AAGCACAGACATTTAAGGAATGG No data
1036081951_1036081959 19 Left 1036081951 8:5566968-5566990 CCTACTCCTGTAATGCCAGGGCA No data
Right 1036081959 8:5567010-5567032 AAGCACAGACATTTAAGGAATGG No data
1036081953_1036081959 13 Left 1036081953 8:5566974-5566996 CCTGTAATGCCAGGGCATAGGAA No data
Right 1036081959 8:5567010-5567032 AAGCACAGACATTTAAGGAATGG No data
1036081950_1036081959 20 Left 1036081950 8:5566967-5566989 CCCTACTCCTGTAATGCCAGGGC No data
Right 1036081959 8:5567010-5567032 AAGCACAGACATTTAAGGAATGG No data
1036081955_1036081959 4 Left 1036081955 8:5566983-5567005 CCAGGGCATAGGAAGGCCAGAAG No data
Right 1036081959 8:5567010-5567032 AAGCACAGACATTTAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036081959 Original CRISPR AAGCACAGACATTTAAGGAA TGG Intergenic
No off target data available for this crispr