ID: 1036081960

View in Genome Browser
Species Human (GRCh38)
Location 8:5567011-5567033
Sequence AGCACAGACATTTAAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036081948_1036081960 22 Left 1036081948 8:5566966-5566988 CCCCTACTCCTGTAATGCCAGGG No data
Right 1036081960 8:5567011-5567033 AGCACAGACATTTAAGGAATGGG No data
1036081950_1036081960 21 Left 1036081950 8:5566967-5566989 CCCTACTCCTGTAATGCCAGGGC No data
Right 1036081960 8:5567011-5567033 AGCACAGACATTTAAGGAATGGG No data
1036081951_1036081960 20 Left 1036081951 8:5566968-5566990 CCTACTCCTGTAATGCCAGGGCA No data
Right 1036081960 8:5567011-5567033 AGCACAGACATTTAAGGAATGGG No data
1036081953_1036081960 14 Left 1036081953 8:5566974-5566996 CCTGTAATGCCAGGGCATAGGAA No data
Right 1036081960 8:5567011-5567033 AGCACAGACATTTAAGGAATGGG No data
1036081955_1036081960 5 Left 1036081955 8:5566983-5567005 CCAGGGCATAGGAAGGCCAGAAG No data
Right 1036081960 8:5567011-5567033 AGCACAGACATTTAAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036081960 Original CRISPR AGCACAGACATTTAAGGAAT GGG Intergenic
No off target data available for this crispr