ID: 1036084615

View in Genome Browser
Species Human (GRCh38)
Location 8:5599936-5599958
Sequence TCCCAAGGGCAGATCCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036084615_1036084618 14 Left 1036084615 8:5599936-5599958 CCAGCTAGGATCTGCCCTTGGGA No data
Right 1036084618 8:5599973-5599995 TAATTCTAATCAGCCACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036084615 Original CRISPR TCCCAAGGGCAGATCCTAGC TGG (reversed) Intergenic
No off target data available for this crispr