ID: 1036084910

View in Genome Browser
Species Human (GRCh38)
Location 8:5602758-5602780
Sequence ATAAAGCCTCTGGATTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036084910_1036084912 0 Left 1036084910 8:5602758-5602780 CCTAGGTAATCCAGAGGCTTTAT No data
Right 1036084912 8:5602781-5602803 ATCATTATGAGCAGACTACCTGG No data
1036084910_1036084916 30 Left 1036084910 8:5602758-5602780 CCTAGGTAATCCAGAGGCTTTAT No data
Right 1036084916 8:5602811-5602833 CGTAGGTTCTACTTCCAAAGTGG No data
1036084910_1036084914 13 Left 1036084910 8:5602758-5602780 CCTAGGTAATCCAGAGGCTTTAT No data
Right 1036084914 8:5602794-5602816 GACTACCTGGGAACAAACGTAGG No data
1036084910_1036084913 1 Left 1036084910 8:5602758-5602780 CCTAGGTAATCCAGAGGCTTTAT No data
Right 1036084913 8:5602782-5602804 TCATTATGAGCAGACTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036084910 Original CRISPR ATAAAGCCTCTGGATTACCT AGG (reversed) Intergenic
No off target data available for this crispr