ID: 1036088987

View in Genome Browser
Species Human (GRCh38)
Location 8:5644550-5644572
Sequence TTTCCAGGAGGGCCGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036088987_1036088992 -4 Left 1036088987 8:5644550-5644572 CCTTTGTTCGGCCCTCCTGGAAA No data
Right 1036088992 8:5644569-5644591 GAAAGGTAAGCAGTCATCTTAGG No data
1036088987_1036088995 14 Left 1036088987 8:5644550-5644572 CCTTTGTTCGGCCCTCCTGGAAA No data
Right 1036088995 8:5644587-5644609 TTAGGGAACAAATTCAGGAGAGG No data
1036088987_1036088993 -3 Left 1036088987 8:5644550-5644572 CCTTTGTTCGGCCCTCCTGGAAA No data
Right 1036088993 8:5644570-5644592 AAAGGTAAGCAGTCATCTTAGGG No data
1036088987_1036088994 9 Left 1036088987 8:5644550-5644572 CCTTTGTTCGGCCCTCCTGGAAA No data
Right 1036088994 8:5644582-5644604 TCATCTTAGGGAACAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036088987 Original CRISPR TTTCCAGGAGGGCCGAACAA AGG (reversed) Intergenic
No off target data available for this crispr