ID: 1036088995

View in Genome Browser
Species Human (GRCh38)
Location 8:5644587-5644609
Sequence TTAGGGAACAAATTCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036088990_1036088995 2 Left 1036088990 8:5644562-5644584 CCTCCTGGAAAGGTAAGCAGTCA No data
Right 1036088995 8:5644587-5644609 TTAGGGAACAAATTCAGGAGAGG No data
1036088991_1036088995 -1 Left 1036088991 8:5644565-5644587 CCTGGAAAGGTAAGCAGTCATCT No data
Right 1036088995 8:5644587-5644609 TTAGGGAACAAATTCAGGAGAGG No data
1036088989_1036088995 3 Left 1036088989 8:5644561-5644583 CCCTCCTGGAAAGGTAAGCAGTC No data
Right 1036088995 8:5644587-5644609 TTAGGGAACAAATTCAGGAGAGG No data
1036088987_1036088995 14 Left 1036088987 8:5644550-5644572 CCTTTGTTCGGCCCTCCTGGAAA No data
Right 1036088995 8:5644587-5644609 TTAGGGAACAAATTCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036088995 Original CRISPR TTAGGGAACAAATTCAGGAG AGG Intergenic
No off target data available for this crispr