ID: 1036094231

View in Genome Browser
Species Human (GRCh38)
Location 8:5705705-5705727
Sequence GATGAAAGAGTTGAACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036094231_1036094234 -8 Left 1036094231 8:5705705-5705727 CCCTGAGGTTCAACTCTTTCATC No data
Right 1036094234 8:5705720-5705742 CTTTCATCTAATGTAGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036094231 Original CRISPR GATGAAAGAGTTGAACCTCA GGG (reversed) Intergenic