ID: 1036094231 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:5705705-5705727 |
| Sequence | GATGAAAGAGTTGAACCTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036094231_1036094234 | -8 | Left | 1036094231 | 8:5705705-5705727 | CCCTGAGGTTCAACTCTTTCATC | No data | ||
| Right | 1036094234 | 8:5705720-5705742 | CTTTCATCTAATGTAGGAAACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036094231 | Original CRISPR | GATGAAAGAGTTGAACCTCA GGG (reversed) | Intergenic | ||