ID: 1036095751

View in Genome Browser
Species Human (GRCh38)
Location 8:5723829-5723851
Sequence GCAAATTCTGTCTCACACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036095748_1036095751 6 Left 1036095748 8:5723800-5723822 CCCTTTCAAGGCTAAGGAACAGG No data
Right 1036095751 8:5723829-5723851 GCAAATTCTGTCTCACACGCAGG No data
1036095750_1036095751 5 Left 1036095750 8:5723801-5723823 CCTTTCAAGGCTAAGGAACAGGA No data
Right 1036095751 8:5723829-5723851 GCAAATTCTGTCTCACACGCAGG No data
1036095744_1036095751 28 Left 1036095744 8:5723778-5723800 CCATTCCTAAGTAACGGGGTGAC No data
Right 1036095751 8:5723829-5723851 GCAAATTCTGTCTCACACGCAGG No data
1036095745_1036095751 23 Left 1036095745 8:5723783-5723805 CCTAAGTAACGGGGTGACCCTTT No data
Right 1036095751 8:5723829-5723851 GCAAATTCTGTCTCACACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036095751 Original CRISPR GCAAATTCTGTCTCACACGC AGG Intergenic