ID: 1036097879

View in Genome Browser
Species Human (GRCh38)
Location 8:5743835-5743857
Sequence CAGAAGTTATTAAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036097878_1036097879 15 Left 1036097878 8:5743797-5743819 CCATAATTATGGTACTGAACTGC No data
Right 1036097879 8:5743835-5743857 CAGAAGTTATTAAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036097879 Original CRISPR CAGAAGTTATTAAAGTGTCC AGG Intergenic
No off target data available for this crispr