ID: 1036102459

View in Genome Browser
Species Human (GRCh38)
Location 8:5802073-5802095
Sequence TTCTTCCCCTACCCATGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036102459_1036102464 6 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102464 8:5802102-5802124 CAGTGGTCATTATTAGGAAGGGG No data
1036102459_1036102465 14 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102465 8:5802110-5802132 ATTATTAGGAAGGGGTCTGCAGG No data
1036102459_1036102466 15 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102466 8:5802111-5802133 TTATTAGGAAGGGGTCTGCAGGG No data
1036102459_1036102462 4 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102462 8:5802100-5802122 AACAGTGGTCATTATTAGGAAGG No data
1036102459_1036102463 5 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102463 8:5802101-5802123 ACAGTGGTCATTATTAGGAAGGG No data
1036102459_1036102468 30 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102468 8:5802126-5802148 CTGCAGGGTGACCCCACATTGGG No data
1036102459_1036102467 29 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102467 8:5802125-5802147 TCTGCAGGGTGACCCCACATTGG No data
1036102459_1036102461 0 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102461 8:5802096-5802118 TCACAACAGTGGTCATTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036102459 Original CRISPR TTCTTCCCCTACCCATGACA TGG (reversed) Intergenic
No off target data available for this crispr