ID: 1036102466

View in Genome Browser
Species Human (GRCh38)
Location 8:5802111-5802133
Sequence TTATTAGGAAGGGGTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036102459_1036102466 15 Left 1036102459 8:5802073-5802095 CCATGTCATGGGTAGGGGAAGAA No data
Right 1036102466 8:5802111-5802133 TTATTAGGAAGGGGTCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036102466 Original CRISPR TTATTAGGAAGGGGTCTGCA GGG Intergenic
No off target data available for this crispr