ID: 1036103322

View in Genome Browser
Species Human (GRCh38)
Location 8:5811836-5811858
Sequence CATATTCAGCAGACAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036103321_1036103322 7 Left 1036103321 8:5811806-5811828 CCTAGAAACTAAACTTCGCTCTT No data
Right 1036103322 8:5811836-5811858 CATATTCAGCAGACAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036103322 Original CRISPR CATATTCAGCAGACAGTGCA AGG Intergenic
No off target data available for this crispr