ID: 1036104166

View in Genome Browser
Species Human (GRCh38)
Location 8:5822568-5822590
Sequence TGTCATTCCCCTATTGGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036104160_1036104166 3 Left 1036104160 8:5822542-5822564 CCTGATGCAGGTAGCCCCTACTG 0: 23
1: 41
2: 46
3: 85
4: 174
Right 1036104166 8:5822568-5822590 TGTCATTCCCCTATTGGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036104166 Original CRISPR TGTCATTCCCCTATTGGGTA CGG Intergenic
No off target data available for this crispr