ID: 1036105181

View in Genome Browser
Species Human (GRCh38)
Location 8:5830457-5830479
Sequence GGGGTGCCTCCTCATGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036105175_1036105181 9 Left 1036105175 8:5830425-5830447 CCTCATTCCTGAGGCTGCTGCAG No data
Right 1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG No data
1036105177_1036105181 2 Left 1036105177 8:5830432-5830454 CCTGAGGCTGCTGCAGTGAGGCA No data
Right 1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG No data
1036105173_1036105181 26 Left 1036105173 8:5830408-5830430 CCAGGTGGGTCTTAGTTCCTCAT No data
Right 1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036105181 Original CRISPR GGGGTGCCTCCTCATGAGAG AGG Intergenic
No off target data available for this crispr