ID: 1036105187

View in Genome Browser
Species Human (GRCh38)
Location 8:5830485-5830507
Sequence AAACCACCCCCAGAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036105183_1036105187 -1 Left 1036105183 8:5830463-5830485 CCTCCTCATGAGAGAGGACCGGA No data
Right 1036105187 8:5830485-5830507 AAACCACCCCCAGAGGAGAATGG No data
1036105177_1036105187 30 Left 1036105177 8:5830432-5830454 CCTGAGGCTGCTGCAGTGAGGCA No data
Right 1036105187 8:5830485-5830507 AAACCACCCCCAGAGGAGAATGG No data
1036105184_1036105187 -4 Left 1036105184 8:5830466-5830488 CCTCATGAGAGAGGACCGGAAAC No data
Right 1036105187 8:5830485-5830507 AAACCACCCCCAGAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036105187 Original CRISPR AAACCACCCCCAGAGGAGAA TGG Intergenic
No off target data available for this crispr