ID: 1036111218

View in Genome Browser
Species Human (GRCh38)
Location 8:5905051-5905073
Sequence GAGAACAGAGGCAAGTCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036111216_1036111218 -1 Left 1036111216 8:5905029-5905051 CCTATGAGAACAAAAGGGAACAG No data
Right 1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036111218 Original CRISPR GAGAACAGAGGCAAGTCTGC CGG Intergenic
No off target data available for this crispr