ID: 1036115667

View in Genome Browser
Species Human (GRCh38)
Location 8:5958220-5958242
Sequence CTCTGCAGTTTTTCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036115663_1036115667 22 Left 1036115663 8:5958175-5958197 CCCTCAAGCTCATATACTCAAAA No data
Right 1036115667 8:5958220-5958242 CTCTGCAGTTTTTCTTTTGTGGG No data
1036115664_1036115667 21 Left 1036115664 8:5958176-5958198 CCTCAAGCTCATATACTCAAAAT No data
Right 1036115667 8:5958220-5958242 CTCTGCAGTTTTTCTTTTGTGGG No data
1036115662_1036115667 30 Left 1036115662 8:5958167-5958189 CCTGAATTCCCTCAAGCTCATAT No data
Right 1036115667 8:5958220-5958242 CTCTGCAGTTTTTCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036115667 Original CRISPR CTCTGCAGTTTTTCTTTTGT GGG Intergenic
No off target data available for this crispr