ID: 1036123854

View in Genome Browser
Species Human (GRCh38)
Location 8:6045365-6045387
Sequence GCGGGAACAGGGGTTGCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036123854_1036123867 15 Left 1036123854 8:6045365-6045387 CCGGGTGCAACCCCTGTTCCCGC No data
Right 1036123867 8:6045403-6045425 CACACCTCCCCACAAGCTGAGGG No data
1036123854_1036123869 17 Left 1036123854 8:6045365-6045387 CCGGGTGCAACCCCTGTTCCCGC No data
Right 1036123869 8:6045405-6045427 CACCTCCCCACAAGCTGAGGGGG No data
1036123854_1036123874 27 Left 1036123854 8:6045365-6045387 CCGGGTGCAACCCCTGTTCCCGC No data
Right 1036123874 8:6045415-6045437 CAAGCTGAGGGGGCCAGCTCTGG No data
1036123854_1036123866 14 Left 1036123854 8:6045365-6045387 CCGGGTGCAACCCCTGTTCCCGC No data
Right 1036123866 8:6045402-6045424 CCACACCTCCCCACAAGCTGAGG No data
1036123854_1036123868 16 Left 1036123854 8:6045365-6045387 CCGGGTGCAACCCCTGTTCCCGC No data
Right 1036123868 8:6045404-6045426 ACACCTCCCCACAAGCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036123854 Original CRISPR GCGGGAACAGGGGTTGCACC CGG (reversed) Intergenic