ID: 1036125976

View in Genome Browser
Species Human (GRCh38)
Location 8:6062270-6062292
Sequence CTGGAGACACAGAAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036125974_1036125976 2 Left 1036125974 8:6062245-6062267 CCGGGCTAATCTCAAGTTTTGGA No data
Right 1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG No data
1036125970_1036125976 7 Left 1036125970 8:6062240-6062262 CCCTCCCGGGCTAATCTCAAGTT No data
Right 1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG No data
1036125972_1036125976 3 Left 1036125972 8:6062244-6062266 CCCGGGCTAATCTCAAGTTTTGG No data
Right 1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG No data
1036125971_1036125976 6 Left 1036125971 8:6062241-6062263 CCTCCCGGGCTAATCTCAAGTTT No data
Right 1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG No data
1036125969_1036125976 14 Left 1036125969 8:6062233-6062255 CCAAGAACCCTCCCGGGCTAATC No data
Right 1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG No data
1036125966_1036125976 25 Left 1036125966 8:6062222-6062244 CCTGGATGAAGCCAAGAACCCTC 0: 3
1: 78
2: 137
3: 270
4: 423
Right 1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036125976 Original CRISPR CTGGAGACACAGAAAGAGAA AGG Intergenic
No off target data available for this crispr