ID: 1036126537

View in Genome Browser
Species Human (GRCh38)
Location 8:6068267-6068289
Sequence CAAGATGATGCCATGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036126537_1036126542 16 Left 1036126537 8:6068267-6068289 CCACCCTACATGGCATCATCTTG No data
Right 1036126542 8:6068306-6068328 AGAGACTATGGTAGACCAGGTGG No data
1036126537_1036126540 4 Left 1036126537 8:6068267-6068289 CCACCCTACATGGCATCATCTTG No data
Right 1036126540 8:6068294-6068316 AGTCTCTTCAGAAGAGACTATGG No data
1036126537_1036126541 13 Left 1036126537 8:6068267-6068289 CCACCCTACATGGCATCATCTTG No data
Right 1036126541 8:6068303-6068325 AGAAGAGACTATGGTAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036126537 Original CRISPR CAAGATGATGCCATGTAGGG TGG (reversed) Intergenic
No off target data available for this crispr