ID: 1036137813

View in Genome Browser
Species Human (GRCh38)
Location 8:6178341-6178363
Sequence CAAGCAAATAAGCGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036137813_1036137816 4 Left 1036137813 8:6178341-6178363 CCCTCTTTCCGCTTATTTGCTTG No data
Right 1036137816 8:6178368-6178390 CAACAGAAAATAGAAAATACTGG No data
1036137813_1036137817 26 Left 1036137813 8:6178341-6178363 CCCTCTTTCCGCTTATTTGCTTG No data
Right 1036137817 8:6178390-6178412 GTTTCCACTACTCAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036137813 Original CRISPR CAAGCAAATAAGCGGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr