ID: 1036138877

View in Genome Browser
Species Human (GRCh38)
Location 8:6188031-6188053
Sequence AGATTTTCACATATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036138877_1036138879 21 Left 1036138877 8:6188031-6188053 CCTGACTCCATATGTGAAAATCT No data
Right 1036138879 8:6188075-6188097 CTTATACTGCTATTATTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036138877 Original CRISPR AGATTTTCACATATGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr