ID: 1036140339

View in Genome Browser
Species Human (GRCh38)
Location 8:6201688-6201710
Sequence CTCTGCCCTCACGGAGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036140339_1036140345 15 Left 1036140339 8:6201688-6201710 CCCAAGACTCCGTGAGGGCAGAG No data
Right 1036140345 8:6201726-6201748 CTCTTTCCCCCCACCGGCTGAGG No data
1036140339_1036140348 22 Left 1036140339 8:6201688-6201710 CCCAAGACTCCGTGAGGGCAGAG No data
Right 1036140348 8:6201733-6201755 CCCCCACCGGCTGAGGCAAAAGG No data
1036140339_1036140343 9 Left 1036140339 8:6201688-6201710 CCCAAGACTCCGTGAGGGCAGAG No data
Right 1036140343 8:6201720-6201742 TAACCTCTCTTTCCCCCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036140339 Original CRISPR CTCTGCCCTCACGGAGTCTT GGG (reversed) Intergenic
No off target data available for this crispr