ID: 1036147163

View in Genome Browser
Species Human (GRCh38)
Location 8:6264644-6264666
Sequence TAAGATAGTACAGTGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036147163_1036147166 5 Left 1036147163 8:6264644-6264666 CCGGCCACCACTGTACTATCTTA No data
Right 1036147166 8:6264672-6264694 CTTGCTTTTGCTTTGCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036147163 Original CRISPR TAAGATAGTACAGTGGTGGC CGG (reversed) Intergenic
No off target data available for this crispr