ID: 1036154282

View in Genome Browser
Species Human (GRCh38)
Location 8:6327386-6327408
Sequence TAGTTCCAATCCAAGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036154281_1036154282 -5 Left 1036154281 8:6327368-6327390 CCACAAACTCAGGTGGTGTAGTT No data
Right 1036154282 8:6327386-6327408 TAGTTCCAATCCAAGCTCAAAGG No data
1036154272_1036154282 25 Left 1036154272 8:6327338-6327360 CCCACAGCCTTCCATCTGCAAGG No data
Right 1036154282 8:6327386-6327408 TAGTTCCAATCCAAGCTCAAAGG No data
1036154278_1036154282 14 Left 1036154278 8:6327349-6327371 CCATCTGCAAGGGCGAGGACCAC No data
Right 1036154282 8:6327386-6327408 TAGTTCCAATCCAAGCTCAAAGG No data
1036154274_1036154282 24 Left 1036154274 8:6327339-6327361 CCACAGCCTTCCATCTGCAAGGG No data
Right 1036154282 8:6327386-6327408 TAGTTCCAATCCAAGCTCAAAGG No data
1036154277_1036154282 18 Left 1036154277 8:6327345-6327367 CCTTCCATCTGCAAGGGCGAGGA No data
Right 1036154282 8:6327386-6327408 TAGTTCCAATCCAAGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036154282 Original CRISPR TAGTTCCAATCCAAGCTCAA AGG Intergenic
No off target data available for this crispr