ID: 1036162519

View in Genome Browser
Species Human (GRCh38)
Location 8:6402881-6402903
Sequence CCTTGCAAGCTGAAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036162514_1036162519 30 Left 1036162514 8:6402828-6402850 CCCACTCTACTGACTTGACGTCA No data
Right 1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG No data
1036162515_1036162519 29 Left 1036162515 8:6402829-6402851 CCACTCTACTGACTTGACGTCAC No data
Right 1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036162519 Original CRISPR CCTTGCAAGCTGAAGCTGGA TGG Intergenic
No off target data available for this crispr