ID: 1036162519 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:6402881-6402903 |
| Sequence | CCTTGCAAGCTGAAGCTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036162514_1036162519 | 30 | Left | 1036162514 | 8:6402828-6402850 | CCCACTCTACTGACTTGACGTCA | No data | ||
| Right | 1036162519 | 8:6402881-6402903 | CCTTGCAAGCTGAAGCTGGATGG | No data | ||||
| 1036162515_1036162519 | 29 | Left | 1036162515 | 8:6402829-6402851 | CCACTCTACTGACTTGACGTCAC | No data | ||
| Right | 1036162519 | 8:6402881-6402903 | CCTTGCAAGCTGAAGCTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036162519 | Original CRISPR | CCTTGCAAGCTGAAGCTGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||