ID: 1036162884

View in Genome Browser
Species Human (GRCh38)
Location 8:6406126-6406148
Sequence GACCTCCGATCCCGGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036162884_1036162895 -1 Left 1036162884 8:6406126-6406148 CCCCATCCCCGGGATCGGAGGTC No data
Right 1036162895 8:6406148-6406170 CCGGCTCCCCGGAGCAGGCAGGG No data
1036162884_1036162893 -2 Left 1036162884 8:6406126-6406148 CCCCATCCCCGGGATCGGAGGTC No data
Right 1036162893 8:6406147-6406169 TCCGGCTCCCCGGAGCAGGCAGG No data
1036162884_1036162900 11 Left 1036162884 8:6406126-6406148 CCCCATCCCCGGGATCGGAGGTC No data
Right 1036162900 8:6406160-6406182 AGCAGGCAGGGCGGTGCGTCTGG No data
1036162884_1036162892 -6 Left 1036162884 8:6406126-6406148 CCCCATCCCCGGGATCGGAGGTC No data
Right 1036162892 8:6406143-6406165 GAGGTCCGGCTCCCCGGAGCAGG No data
1036162884_1036162901 29 Left 1036162884 8:6406126-6406148 CCCCATCCCCGGGATCGGAGGTC No data
Right 1036162901 8:6406178-6406200 TCTGGCCCTGAACAGTAACGTGG No data
1036162884_1036162896 2 Left 1036162884 8:6406126-6406148 CCCCATCCCCGGGATCGGAGGTC No data
Right 1036162896 8:6406151-6406173 GCTCCCCGGAGCAGGCAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036162884 Original CRISPR GACCTCCGATCCCGGGGATG GGG (reversed) Intergenic