ID: 1036162967

View in Genome Browser
Species Human (GRCh38)
Location 8:6406451-6406473
Sequence CTCGCCGCGCCTCTGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036162967_1036162974 1 Left 1036162967 8:6406451-6406473 CCAGCAGCCAGAGGCGCGGCGAG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1036162974 8:6406475-6406497 CGGAATCGGGCCCCCTCCCCGGG 0: 1
1: 0
2: 2
3: 12
4: 107
1036162967_1036162976 3 Left 1036162967 8:6406451-6406473 CCAGCAGCCAGAGGCGCGGCGAG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1036162976 8:6406477-6406499 GAATCGGGCCCCCTCCCCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 66
1036162967_1036162975 2 Left 1036162967 8:6406451-6406473 CCAGCAGCCAGAGGCGCGGCGAG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1036162975 8:6406476-6406498 GGAATCGGGCCCCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 16
4: 85
1036162967_1036162973 0 Left 1036162967 8:6406451-6406473 CCAGCAGCCAGAGGCGCGGCGAG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1036162973 8:6406474-6406496 GCGGAATCGGGCCCCCTCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036162967 Original CRISPR CTCGCCGCGCCTCTGGCTGC TGG (reversed) Intergenic
900638955 1:3679132-3679154 GTCAGCGCGCCTCTGCCTGCCGG - Intronic
901441388 1:9280441-9280463 CCCGCCCCGCCGCTGGCAGCGGG + Intergenic
901703945 1:11059851-11059873 CTGGCCGGGCCACAGGCTGCAGG + Exonic
903141034 1:21339317-21339339 CTCTCAACGCCTCTGGCTACCGG + Intronic
903172471 1:21562796-21562818 CTCTCCGGGCCTGGGGCTGCAGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
913528112 1:119712819-119712841 TTCGCCGCCCCTCTGCCTCCTGG + Intronic
913714360 1:121519223-121519245 CTGCCCGCGGCACTGGCTGCGGG + Intergenic
916743059 1:167663048-167663070 CACGCCGCTCCTCTGACTGCTGG + Intronic
922196624 1:223364664-223364686 CGCGCCGCGCCGCGGGCTGGGGG - Intergenic
922416381 1:225427070-225427092 GGCGCCGCGCCTCGCGCTGCAGG + Intronic
1064748991 10:18506871-18506893 CTCACTGCGCCTCTGCCTCCAGG + Intronic
1067150237 10:43726505-43726527 CTGGCCCCTCCACTGGCTGCTGG - Intergenic
1067694199 10:48523726-48523748 CTGGCCGCGGCGCCGGCTGCAGG - Intronic
1067731907 10:48818871-48818893 CTGCCTGCGCCTCTGGCTGTGGG - Intronic
1070197951 10:74176473-74176495 ATGGCCGCGCCTCTGGCAACCGG - Intronic
1077311698 11:1891662-1891684 CTCCCCGAGCCTCTCTCTGCTGG - Intronic
1077330724 11:1982778-1982800 CTCTCCGCGCCCCTGCCTCCAGG - Intronic
1077914722 11:6603805-6603827 CTCACCGGGACTCGGGCTGCAGG - Exonic
1080000744 11:27346319-27346341 CTCACCGCACCTCTGCCTCCCGG - Intronic
1081720724 11:45286311-45286333 GTCCCCGCCCCTCTGGCGGCGGG - Exonic
1082796402 11:57381137-57381159 CTCTCAGTGCCTCTGGCTTCAGG + Exonic
1083751582 11:64763811-64763833 CTCCCCCAGCATCTGGCTGCTGG - Intergenic
1084086787 11:66858602-66858624 CACGCAGCGCCTCTGGGTGCTGG + Exonic
1084091411 11:66881512-66881534 CTCGCCCTGCCTCAGCCTGCAGG - Intronic
1089418992 11:118316764-118316786 CACAGCCCGCCTCTGGCTGCAGG - Intergenic
1202813704 11_KI270721v1_random:37957-37979 CTCTCCGCGCCCCTGCCTCCAGG - Intergenic
1091778820 12:3201066-3201088 CTCGGCGCGGCTCTGGCCCCGGG - Intronic
1103595634 12:122022847-122022869 CGCCCCGCGCCCCTGGCCGCTGG - Intronic
1103663616 12:122542688-122542710 CTCACCGCACCTCTGCCTCCTGG - Intronic
1103830780 12:123777358-123777380 CCCGCCGTGCCACTTGCTGCTGG + Intronic
1104724680 12:131068407-131068429 CTCCCCGCCCCTCTGTCTGGTGG - Intronic
1104802636 12:131565176-131565198 CTCCCCGCCCCTCTGTCTGGTGG + Intergenic
1110630266 13:77698453-77698475 CTCGCCGCCCCCCACGCTGCTGG + Intronic
1112622222 13:101064669-101064691 CTAGCCTCTCCCCTGGCTGCTGG - Intronic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1113355214 13:109572603-109572625 GTCGCAGAGCCTGTGGCTGCGGG + Intergenic
1114262745 14:21050296-21050318 CTGGCCGTGCCATTGGCTGCTGG + Intronic
1116835810 14:49768243-49768265 CTCGCGGCCCCTCTGTCTGCAGG + Exonic
1120834451 14:89027415-89027437 AGCGCCGCGCCTCTGCCCGCTGG - Intergenic
1122697411 14:103562775-103562797 CTCGCTGCGCCGCTGGCGGTGGG - Intronic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1123734781 15:23175141-23175163 CTCGCCGGGCCTCCGCCTCCCGG - Intergenic
1124285283 15:28396443-28396465 CTCGCCGGGCCTCCGCCTCCCGG - Intergenic
1124297413 15:28515183-28515205 CTCGCCGGGCCTCCGCCTCCCGG + Intergenic
1124565021 15:30804524-30804546 CTCGCCGGGCCTCTGCCTCCCGG - Intergenic
1124684355 15:31768254-31768276 CTCGCCGCTGCCCGGGCTGCTGG - Intronic
1125509043 15:40283052-40283074 CGCGCCGCTCCTCAAGCTGCTGG + Intronic
1128450615 15:67804077-67804099 CTGGCAGCGTCTCTGCCTGCAGG - Intronic
1129678483 15:77644905-77644927 CTCTCCGCCTCTCGGGCTGCTGG - Intronic
1132105424 15:99059365-99059387 CTCCCCGCGCCTGGGGCTGCAGG - Intergenic
1132392731 15:101450691-101450713 CTCACCCCACCTCTGGATGCGGG - Intronic
1132955484 16:2590566-2590588 CTCGCGGAGCGTCTGGCTGACGG + Intronic
1134492218 16:14703631-14703653 CTCTCCCCACCTCTGGCTGCGGG - Intergenic
1134497599 16:14742753-14742775 CTCTCCCCACCTCTGGCTGCGGG - Intronic
1136364979 16:29805838-29805860 CTCGGGGCGACTCGGGCTGCTGG + Intergenic
1136592236 16:31224449-31224471 CTCGCAGGGCCTGTGGCTGCTGG + Exonic
1136771673 16:32846333-32846355 GCCGCCGCGGCTCTGACTGCAGG - Intergenic
1138196916 16:55058779-55058801 CTCACCTGGGCTCTGGCTGCTGG + Intergenic
1138608660 16:58105738-58105760 CTGGCCCCTCCTCTGTCTGCAGG + Intergenic
1203074099 16_KI270728v1_random:1108444-1108466 GCCGCCGCGGCTCTGACTGCAGG - Intergenic
1142809470 17:2388526-2388548 CTCGCCTCCCTCCTGGCTGCTGG + Intronic
1142863352 17:2776616-2776638 CTCGCCGCGCCTCCGCCACCCGG - Intergenic
1145049527 17:19648642-19648664 CTCTCCCCGGCTCTGGCAGCGGG - Intronic
1147953637 17:44120665-44120687 CTCACCGCACCTCTGTCTCCAGG - Intronic
1148089605 17:45015251-45015273 CTCACCGCACCTCTGCCTCCTGG - Intergenic
1149486478 17:57046473-57046495 CCCGCTGCGCCTGAGGCTGCGGG + Intergenic
1152614988 17:81333854-81333876 CTCCCAGCACCCCTGGCTGCCGG - Intergenic
1152681437 17:81670391-81670413 CTGCCTGCACCTCTGGCTGCCGG - Exonic
1152861511 17:82698950-82698972 CCCGCCCCGCCATTGGCTGCGGG - Intergenic
1153805647 18:8706468-8706490 CTCGCCGCGCCCCTCGCCGCGGG + Intronic
1153935294 18:9914816-9914838 CTCCCCGCGCCGCTGACAGCCGG - Intronic
1158935146 18:62357807-62357829 CTAGCCCAGCCTCTGTCTGCAGG - Intronic
1160507911 18:79437497-79437519 CTCGCCAGGCCGCTGGTTGCAGG + Intronic
1160513161 18:79463705-79463727 CTCTCCGTCCCTCTGCCTGCAGG + Intronic
1160697975 19:493748-493770 CTCCCCGGCCCTCAGGCTGCTGG + Intronic
1160795651 19:944289-944311 CTCCCCGTGTGTCTGGCTGCAGG + Intronic
1161333871 19:3700584-3700606 CTCGAGGCGCTCCTGGCTGCGGG - Intergenic
1161573186 19:5041370-5041392 CTCGCCCAGGCTCTGGATGCGGG + Intronic
1161889963 19:7027846-7027868 CTCGCCGCAACTCTGCCTTCTGG - Intergenic
1161891489 19:7042900-7042922 CTCGCCGCAACTCTGCCTTCTGG + Intergenic
1161893574 19:7061357-7061379 CTCGCCGCAACTCTGCCTTCTGG + Intergenic
1161963496 19:7535366-7535388 CTAGCCTCGCCCCTGGCAGCTGG + Intronic
1162834629 19:13308251-13308273 CTCGCCTGGCCTCTGTCGGCAGG - Exonic
1163758619 19:19121123-19121145 CTCTGGGCGCCTCTGGTTGCTGG - Exonic
1164619709 19:29687348-29687370 CTGGCTGCGCCTCTGGCCCCAGG - Intergenic
1165058536 19:33194177-33194199 CACGCCCCGCCTCGGGGTGCTGG - Intronic
1166856741 19:45786056-45786078 CTCGCCACCCCTCGAGCTGCTGG + Exonic
1168069560 19:53942158-53942180 GGCGCCACGCCTCGGGCTGCAGG - Exonic
925900907 2:8508849-8508871 CTGGCCCAGCCTCTGGCTTCTGG - Intergenic
926216450 2:10908539-10908561 CTCCCCTGGCTTCTGGCTGCAGG + Intergenic
932566069 2:72910511-72910533 CTTGCAGAGCCTCTGACTGCTGG - Intergenic
932599321 2:73112935-73112957 CTCACCGGGCCGCTGGCCGCGGG + Exonic
932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG + Intronic
936279123 2:111122571-111122593 CTCCCCGCGCCGCTGGCGCCGGG - Intronic
938381942 2:130841508-130841530 CTTGGTGCCCCTCTGGCTGCCGG + Intronic
942811658 2:180007023-180007045 CACTCCGCGTCTCTGCCTGCGGG + Exonic
943306766 2:186272290-186272312 CTGGCTGTGCTTCTGGCTGCAGG - Intergenic
944650480 2:201825237-201825259 CTCGCTGCACCTCTGCCTCCTGG - Intronic
947669112 2:231925666-231925688 CTGGCCGAGCCGCAGGCTGCGGG - Exonic
947712990 2:232326368-232326390 CTCGGTGCAACTCTGGCTGCTGG + Intronic
947732673 2:232439824-232439846 CTCGGTGCAACTCTGGCTGCTGG + Intergenic
948468618 2:238163877-238163899 CTGGCCGCGCCCCTGGCCCCGGG + Exonic
948824618 2:240568338-240568360 CTCCCCGCGCCCCTGGCTCCTGG + Intronic
1168886860 20:1266289-1266311 CTCGCCGGGGCTGGGGCTGCCGG - Intronic
1170533305 20:17315644-17315666 ATGGGCGCGCCCCTGGCTGCAGG - Intronic
1170688288 20:18588332-18588354 CCCGGCGCGCCCCTGGCTTCCGG + Intronic
1172526221 20:35601883-35601905 CGCGCTGCGCCTGGGGCTGCTGG - Intergenic
1173704668 20:45101018-45101040 CCCGCCGAGCCTCCTGCTGCAGG + Exonic
1174282456 20:49449081-49449103 CTGGCCTCACCTCTGGCTCCAGG + Intronic
1174373934 20:50112990-50113012 CCCGCGCCGCCTCTGTCTGCTGG - Intronic
1179209705 21:39314177-39314199 CTCGCCGCGCCTCCCGCAGAGGG + Intronic
1180091550 21:45536094-45536116 ATCTCAGCCCCTCTGGCTGCAGG - Intronic
1181570065 22:23763687-23763709 GTCCCCGTGCCTCTGGCTGGAGG + Intronic
1182296076 22:29311752-29311774 CTCCTCGCGGCTCTGGCTCCGGG - Intronic
1182572329 22:31248602-31248624 CTCCCGGCACCTCTGGCTGCAGG - Exonic
1182645090 22:31802201-31802223 CTCACTGCGCCTCTGCCTCCTGG + Intronic
1183482723 22:38073970-38073992 CTCGCTGGGCCTCGGGGTGCTGG + Intronic
1183546225 22:38455859-38455881 CTCGGCGCGCCGCGGGCGGCGGG - Intergenic
1183663675 22:39235410-39235432 CTCCCCGCCCCTCTGGCTAGGGG - Intronic
1183935609 22:41260388-41260410 CTCCCTGCACCCCTGGCTGCAGG - Intronic
1184064397 22:42109010-42109032 TCCTCCCCGCCTCTGGCTGCCGG - Intergenic
1185415276 22:50706016-50706038 CACGCCGCGCCGCCTGCTGCTGG + Intergenic
950767756 3:15286161-15286183 CTAGTGGCCCCTCTGGCTGCCGG + Intronic
953761336 3:45689512-45689534 CCCGCCGCGCCTCAGGCCTCTGG - Intronic
953901237 3:46845426-46845448 CTCCCTGCGCGTCTGTCTGCAGG + Intergenic
954228655 3:49199561-49199583 CTGTCCCCACCTCTGGCTGCTGG - Intronic
954661909 3:52230914-52230936 CCCGCTGGGCCTCAGGCTGCAGG + Exonic
954812272 3:53255665-53255687 CTCGCAGGGCCCCGGGCTGCAGG - Intronic
957475247 3:80713883-80713905 CTCACCACGCCTCTGCCTTCTGG - Intergenic
961599891 3:128052405-128052427 CGCGCCGCGCCGCTTGCCGCCGG + Exonic
961745627 3:129062021-129062043 CTATCTGCGCCTCTGGCTGGAGG + Exonic
963103020 3:141623622-141623644 CTTGGCCCGCCTGTGGCTGCTGG + Intergenic
963605599 3:147409934-147409956 CGCGCCGCGCCATTGCCTGCAGG + Exonic
968882440 4:3308381-3308403 CTCGGCGCTCCTCTTGCTGCAGG + Intronic
969669197 4:8580425-8580447 CTCGCCACGCCTCTCCCTCCAGG - Intronic
981603833 4:146521985-146522007 CCCCCAGCGCCTCTGGCCGCGGG + Intergenic
981713671 4:147732549-147732571 TTCCCCGTTCCTCTGGCTGCTGG - Intronic
983088310 4:163473821-163473843 CTCGCCTCCCCTCTGCCTGAAGG + Intergenic
983281619 4:165688091-165688113 CTAGCTGTGCCTCTAGCTGCTGG + Intergenic
984698136 4:182799610-182799632 CCTGCCGCGCCACTTGCTGCTGG - Exonic
987253818 5:16127827-16127849 CTGCCCGCCCCTCTGGCTTCTGG + Intronic
990582031 5:57174326-57174348 CTCGCCGCCCCTCCGTCGGCGGG - Intronic
998130021 5:139647151-139647173 GAGGCCGCGCCTGTGGCTGCAGG + Intergenic
998252860 5:140564332-140564354 CTCTCTGCGCCGCAGGCTGCGGG + Intronic
998282978 5:140830014-140830036 CTCTCCGCGCCACCGGCTGCTGG + Exonic
998284287 5:140843244-140843266 CTCTCCGCGCCACCGTCTGCTGG + Exonic
998504029 5:142657646-142657668 CTCGCCATGCTGCTGGCTGCTGG + Intronic
1003074571 6:2971697-2971719 CTCGCGGCCCCTCCGGCTGGCGG - Intronic
1003245807 6:4381124-4381146 CTGGCTGTGCCCCTGGCTGCCGG - Intergenic
1005822182 6:29607200-29607222 CTAGGCCCGCCTCTGGCTCCTGG - Exonic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1006473084 6:34238796-34238818 CTCCCCCCACCTCTTGCTGCTGG - Intronic
1007666503 6:43516680-43516702 ATCGCCGGCCCTCCGGCTGCTGG + Intronic
1016010774 6:139135568-139135590 CCCGCCGCGCCTCCGGCGCCCGG - Exonic
1019780825 7:2938684-2938706 CTCGCAGCTCCTCTGCCTGGCGG + Exonic
1022104328 7:27187737-27187759 CTCGCCCCGCCCCTGGGTGAAGG + Intergenic
1023418250 7:39951195-39951217 CTCCCCGCGCCGCTGGGTGCCGG - Exonic
1023725771 7:43141571-43141593 CTCACCGCGCCTCCGCCTCCTGG + Intronic
1023996801 7:45163519-45163541 CTCCACGACCCTCTGGCTGCTGG - Intronic
1025949392 7:66131834-66131856 CTCGGCTCACCTCTGGCTCCCGG + Intronic
1028173636 7:87628540-87628562 CTCGGCGCGCCGCCGACTGCCGG - Exonic
1031001613 7:116421918-116421940 CTCACTGCACCTCTGGCTCCCGG - Intronic
1033366031 7:140673161-140673183 CTCGCCGGGCCTCAGGCCGGAGG - Exonic
1034088210 7:148339504-148339526 CCCGCCGGGACTCGGGCTGCCGG + Intronic
1035764840 8:2097907-2097929 CTCGCCCCTCCTGTTGCTGCTGG + Intronic
1036162967 8:6406451-6406473 CTCGCCGCGCCTCTGGCTGCTGG - Intergenic
1036776727 8:11617893-11617915 CCCGCCCTGCCTGTGGCTGCTGG - Intergenic
1039843461 8:41309388-41309410 CTCGCCGCACCTCCGGGAGCCGG - Exonic
1042908616 8:73801014-73801036 CTCACCGCACCTCTGCCTTCTGG - Intronic
1043296207 8:78666282-78666304 CCCGCCGCGCCTCCGGAGGCTGG + Intronic
1044607050 8:94056980-94057002 CTCGCCGCGCCCCTGTCTTAAGG + Intergenic
1045509975 8:102806576-102806598 CTCTCCCCGCCCCTGGCAGCGGG + Intergenic
1045965978 8:108024943-108024965 CTCGCTGCCCCTCTGCCTCCTGG - Intronic
1049219264 8:141421465-141421487 GTCGCCGCGCCTCCTGCTGAGGG + Exonic
1049346506 8:142142081-142142103 CTCGCCCTGCCATTGGCTGCTGG + Intergenic
1051591138 9:18777487-18777509 CGCGCAGCTCCTCGGGCTGCTGG - Exonic
1057869725 9:98708735-98708757 CATGCCGCGCCGCGGGCTGCGGG + Exonic
1061913667 9:133738144-133738166 CTCCCTCTGCCTCTGGCTGCAGG - Intronic
1062518661 9:136948244-136948266 CCCTCCACGCCTCTGACTGCAGG + Intronic
1187046846 X:15655443-15655465 CTCGCCTCGGCTCTGCCTCCGGG + Intronic
1189446224 X:41084622-41084644 CTGGCCGGGCCACTGGCTGCGGG - Intergenic
1195966856 X:110436819-110436841 CTCTCAGCTCCTCAGGCTGCTGG - Intronic
1197335280 X:125204233-125204255 CTCGCCGCGCTCCCGGGTGCTGG + Intergenic
1199744606 X:150764046-150764068 CCCACCCCGCCACTGGCTGCAGG + Intronic
1199772355 X:150983227-150983249 CTCGCCTGGCCATTGGCTGCGGG - Intronic
1200091901 X:153639951-153639973 CTAGCAGTGCCTCTGGCGGCCGG - Intergenic